Distribution characteristics and clinical phenotype analyses of hemoglobin variants in the Z region of Central Guangxi, Southern China

ABSTRACT

Objective

To investigate the molecular diagnosis of hemoglobin variants in Z region by Capillary electrophoresis in Central Guangxi, Southern China, and analyze their distribution and phenotypic characteristics, to provide a reference for clinical consultation and prenatal diagnosis for couples.

Methods

A total of 23,709 subjects were collected for blood routine analysis, hemoglobin analysis, and common α- and β-globin gene loci in Chinese population. The hemoglobin electrophoresis components were divided into Zone 1-Zone 15 (Z1-Z15) by Capillary zone electrophoresis (CE). For samples not clearly detected by the conventional technology, Sanger sequencing, and multiplex ligation-dependent probe amplification (MLPA) were used. Single-molecule real-time (SMRT) sequencing technology was used to analyze rare-type genes in a sample with a structural variation.

Results

Ten rare hemoglobin variants distributed in Z region were detected in 23,709 samples, including Hb Cibeles, which was reported for the first time in Asia; Hb J-Broussais, Hb G-Honolulu and J-Wenchang-Wuming, they were first reported in Guangxi; 1 case of Hb Anti-Lepore Liuzhou, which was a newly discovered hemoglobin variant; hemoglobin variants Hb G-Siriraj, Hb Handsworth, Hb Q-Thailand, Hb Ube-2, Hb NewYork were also detected.

Conclusion

There are a few studies on rare hemoglobin variants in Z region in Southern China. Ten rare hemoglobin variants were found in this study. The hematological phenotype and component content of hemoglobin variants are related to the occurrence of thalassemia. This study enriched the data of rare hemoglobin variants in Southern China and provided a comprehensive data basis for prenatal diagnosis of hemoglobin variants in this area.

KEYWORDS:

• Thalassemia
• rare hemoglobin variant
• Hb Z
• Hb Cibeles
• Hb anti-Lepore Liuzhou
• single-molecule real-time (SMRT)
• clinical phenotype
• distribution characteristics

1. Introduction

As one of the most common genetic diseases, hemoglobin diseases are mainly divided into two categories: abnormal hemoglobinopathy and thalassemia. An abnormal hemoglobinopathy is a group of hereditary diseases in which the globin gene is defective and the primary structure of the hemoglobin molecule is changed. Some hemoglobin variants may have a thalassemia-like phenotype, which may lead to severe phenotype in patients when they are co-inherited with thalassemia. With the increase of age, some asymptomatic carriers of hemoglobin variants may have gradually aggravated clinical symptoms [1]. More than 700 types of hemoglobin variants have been found in the HbVar database. About 30% of carriers have abnormal hemoglobin function [2]. These variants are obvious regional or group specificity, and different ethnic groups have their own unique gene mutation spectrum [3]. Hemoglobinopathies are mainly distributed in tropical and subtropical regions, with high incidence in Guangdong, Guangxi, Hainan and other provinces south of the Yangtze River in China [4]. Studies over the years have shown that Guangxi is a provincial-level administrative region with the highest carrying rate of hemoglobinopathy in China, and there are many kinds of hemoglobin variants in this region [5]. At present, blood cells and hemoglobin tests are mainly used as a first-tier screening method in China. Methods for the hemoglobin components analysis include high-performance liquid chromatography (HPLC) and automatic capillary electrophoresis (CE) [6]. Among them, CE can detect various variants (S, C, E, D and Hb Bart’s) [7]. It can completely separate the hemoglobin components that cannot be separated by HPLC and has the advantages of high sensitivity and high detection flux. Molecular detection techniques for hemoglobinopathy mainly include Gap polymerase chain reaction (Gap-PCR) [8], reverse dot blot technique (RDB) [9], multiplex ligation-dependent probe amplification (MLPA) [10], and Sanger sequencing [11]. Among them, Gap-PCR and RDB are the first-line detection technologies in China, but the detection range is very limited, and many rare thalassemia genotypes cannot be determined. Sequencing technology is the gold standard for the diagnosis of thalassemia. Compared with traditional methods, the third-generation sequencing technology (SMRT) [12] developed in recent years can detect more hemoglobin variation sites on HBA1, HBA2 and HBB genes, and can resolve the problem that is difficult to be detected by other sequencing technologies. DNA sequencing technology (especially SMRT) has a high cost and it is difficult to popularize temporarily. It can be seen that different techniques have their own advantages and limitations, and there may be missed diagnoses when they are used alone. Although the prevalence of thalassemia in Southern China has been reported by several investigations, there is still no comprehensive analysis of hemoglobin variants using capillary electrophoresis and molecular techniques. In this study, we analyzed the hematological phenotype, component content and thalassemia involved with hemoglobin variants in central Southern China, which enriched the data of hemoglobin variants in this region and provided a comprehensive data basis for the population with hemoglobin variants.

2. Objects and methods

2.1. Object

A total of 23,709 subjects whowent to Liuzhou Maternal and Child Healthcare Hospital in Guangxi, China from 2020 to 2021, included 11,833 males and 11,876 females, ranging in age from 10 days to 84 years old. The average age was 27.59 ± 13.20 years. Three tubes of EDTA-K2 anticoagulant blood (2 mL in each tube) were collected for routine blood analysis, hemoglobin electrophoresis analysis, and thalassemia gene detection. This study was approved by the Ethics Committee of our hospital, and all subjects signed informed consent. This study complies with the requirements of the Declaration of Helsinki.

2.2. Reagents and instruments

XE-2100 blood cell analyzer and supporting reagents from Sysmex Company, Japan; Capillarys2 capillary electrophoresis instrument and supporting reagents from SEBIA Company, France; Lab-Aid 820 automatic nucleic acid extractor and supporting reagents from Xiamen Zhishan Company, China; ABI ProFlex 96 × 2 well amplification instrument and 3500Dx genetic analyzer from ABI Company, United States; Gel Doc gel imager from BIO-RAD, United States; common thalassemia gene detection kits from Shenzhen Yishengtang Biological Enterprise Co., Ltd., China and Shenzhen Yaneng Biological Co., Ltd., China.

2.3. Methods

2.3.1. Hematology screening

We used an XE-2100 blood cell analyzer for blood routine analysis. Hemoglobin electrophoresis was analyzed by the Capillarys2 capillary electrophoresis apparatus. The capillarys system uses liquid electrophoresis in the capillary to separate various hemoglobin and hemoglobin variants in the alkaline buffer with specific PH values by using the mobility of charged molecules and quantifies them at the extreme negative absorption rate of 415 nm. The main analysis indexes and reference ranges are as follows: Hb A > 94.5%; Hb A2, 2.4-3.4%; Hb F < 2.0%. According to the peak time, Hb A (about 150s), Hb F (about 182s), and Hb A₂ (about 243s) were distinguished from other abnormal hemoglobin variants in Zones 7 and 9, and the abnormal hemoglobin can be screened for gene analysis.

2.3.2. Genomic DNA extraction

DNA was extracted according to the operating instructions of the Lab-Aid 820 nucleic acid extraction kit. DNA concentration and purity were detected by the ASP-2680 nucleic acid analyzer, A260/A280 was 1.6-1.9, and the concentration was 20–30 ng/µl.

2.3.3. Common thalassemia genetic testing

Gap-PCR was used to detect 4 deletion types of ɑ-thalassemia in the Chinese population, including –^SEA (Southeast Asia), –^THAI (Thailand), -α^3.7 (rightward), -α^4.2 (leftward). RDB was used to detect 3 non-deletion types of ɑ-thalassemia including Hb Constant Spring (HBA2: c.427T > C), Hb Quong Sze (HBA2: c.377T > C), Hb Westmead (HBA2: c .369G > C) and 17 β-thalassemia mutations including codons 41/42 (-TCTT) (HBB: c.126_129delCTTT), IVS-II-654(C > T) (HBB: c.316-197C > T), codon 17 (A > T) (HBB: c.52A > T), −28(A > G) (HBB: c.−76A > G), codon 26 (or Hb E) (G > A) (HBB: c.79G > A), codons 71/72 (+A) (HBB: c. 216_217insA), codon 43 (G > T) (HBB: c.130 G > T), −29 (A > G) (HBB: c.−79A > G), initiation codon (T > G) (HBB: c.2T > G), codons 14/15 (+G) (HBB: c.45_46insG), codons 27/28 (+C) (HBB: c.84_85insC), −32(C > A) (HBB: c.−82C > A), −30(T > C) (HBB: c.−80T > C), IVS-Ⅰ-1(G > T) (HBB: c.92 + 1G > T), IVS-Ⅰ-5(G > C) (HBB: c.92 + 5G > C), CD31(-C) (HBB: c .94delC), CAP + 40-+43.

2.3.4. Sanger sequencing

DNA sequencing was performed by Sanger sequencing. We used NM_000517 as the reference sequence to detect α-globin genes (HBA1, HBA2) and β-globin gene (HBB) for samples with hemoglobin variant detected (Table 1). We used 50 ng of genomic DNA and 20 pmol of forward (F) and reverse (R) primers to amplify the PCR apparatus (C1000 Thermal Cycler; Bio-Rad Laboratories) and then sequenced on the ABI PRISM® 3130 automated sequencer (Applied Biosystems). DNA sequencing results were compared with the UCSC database (https://genome.ucsc.edu/) and HBVar database (http://globin.bx.psu.edu/cgi-bin/hbvar/counter) by using Seqman software.

Table 1. Primer sequences of thalassemia gene by Sanger sequencing.

Primer 5′-3′	Primer sequence
HBA1-F	TGGAGGGTGGAGACGTCCTG
HBA1-R	TCCATCCCCTCCTCCCGCCCCTGCCTTTTC
HBA2-F	TGGAGGGTGGAGACGTCCTG
HBA2-R	CCATTGTTGGCACATTCCGG
AvaII-β FP	TTGGGGATCTGTCCACTCCT
AvaII-β RP	CCAGCCTTATCCCAACCATAAAATAA
HBB-FP	AACTCCTAAGCCAGTGCCAG
HBB-RP	ATGCACTGACCTCCCACATTCCCT

2.3.5. The copy number variation of HBA and HBB genes by MLPA

The SALSA P140-C1 HBA probe of MRC-Holland Company was used to detect the α-thalassemia gene, and the SALSA P102-D1 HBB probe was used to detect the β-thalassemia gene. We used ABI 3500Dx Genetic Analyzer to analyze the amplification product. Cofalyser special software (MRC Holland) was used to analyze the sample data. The normal control ratio was 1.0 ± 0.3. If the ratio is less than 0.7, it means gene deletion, and if it is greater than 1.3, it means gene reiteration.

2.3.6. SMRT and data analysis

Genomic DNA was amplified by PCR with primers that covered the majority of known single nucleotide variations (SNVs), structural variations(SV), insertions and deletions (indels) in the HBA1, HBA2, HBB, HBG and HS40 genes. Using a one-step end-repair and ligation reaction ligated to a barcoded adapter to achiev Prelibrary construction of PCR products. These samples are pooled in equal quantities and converted into the SMRT bell-shaped library by the Sequel Binding and Internal Ctrl Kit 3.0 (Pacific Biosciences). Next, we sequenced the SMRT bell-shaped library by using the CCS mode of the Sequel II platform (Pacific Biosciences), then we converted it to CCS reads, and de-barcoded by lima in the Pbbioconda package (Pacific Biosciences). After the alignment of the processed reads to genome build hg38 by pbmn2 (Pacific Biosciences), we can identify structural variations according to the HbVar, Ithanet and LOVD databases. We use pb amplicon clustering and WhatsHap (version 0.18) software to analyze Haplotype, and use FreeBayes1.3.4 to identify the SNVs and indels.

3. Results

3.1. Hemoglobin electrophoresis analysis

In total, 93 cases of Hb E(in Z4) were detected by the Capillarys2 capillary electrophoresis system, and the diagnosis was confirmed by RDB. There were 81 cases of other rare abnormal hemoglobin in the Hb Zone, we detected 0.73% (174/23709) prevalence of hemoglobinopathy. Rare abnormal hemoglobin in the Hb Zone accounted for 0.34% of the total detected amount (81/23709). They were mainly distributed in the Hb Zone 1(Z1) (2/81), Z3 (1/81), Z5 (2/81), Z7 (12/81), Z6 (5/81), Z8 (1/81), Z11 (45/81), Z12 (8/81) and five cases of hemoglobin variants were detected in the non-single region (Table 2). By RDB and Sange sequencing technique, the detection rate of rare hemoglobin variants in this study was 87.65% (71/81). The sensitivity of the capillary electrophoresis apparatus for the detection of Hb NewYork (in Z11), Hb Q-Thailand (in Z7) and Hb Handsworth (in Z5) was 100%, and the sensitivity for the detection of rare hemoglobin variants in Z12 was 62.5% (5/8). It can be seen that Capillarys2 capillary electrophoresis apparatus is highly sensitive to detect various hemoglobin variants, but it is difficult to diagnose the genotype of hemoglobin variants according to the peak region in CE, so it is necessary to identify the specific genotype by combining the gene detection technology.

Table 2. Type and composition ratio of rare hemoglobin variants in the Hb Zone.

Hb zone	Case (n)	Proportion (%)
Z1	1	1.23
Z3	1	1.23
Z 5	4	4.94
Z6	3	3.70
Z7	12	14.81
Z8	1	1.23
Z11	45	55.56
Z12	8	9.88
Z1,Z5	1	1.23
Z1,Z6	2	2.47
Z6,Z11	1	1.23
Z6,Z12	2	2.47
Total	81	100.00

3.2. Rare hemoglobin variant detection and clinical phenotype

The molecular detection results and regional distribution of 81 Hb Zone samples with rare hemoglobin variants are shown in Table 3. The genotype of 71 cases of hemoglobin variants has been identified, but there are still 10 cases whose genotype could not be identified by the existing detection methods, the detection rate of rare hemoglobin variants by CE was 87.65% (71/81). Hb Cibeles (Figure 1(A,B)), Hb J-Wenchang-Wuming (Figure 2(A,B)) and Hb Ube-2 (Figure 3(A,B)) were detected in Z12, and we found that more types of hemoglobin variants were detected in Z12 than in other regions. The peak time of Hb Cibeles, Hb J-Wenchang-Wuming and Hb Ube-2 was about 102s, 80s and 93s, respectively. The electrophoretic mobility of them was similar, but not completely consistent, indicating that the types of hemoglobin variants detected by capillary electrophoresis in the same region may be different, and it can be roughly distinguished by the peak time. The clinical phenotype and abnormal hemoglobin content of 71 rare hemoglobin variants are shown in Table 4, this allows us to study the effect of hemoglobin variants on clinical phenotypes, among which 25 cases of the Hb Zone hemoglobin variants combined with α-thalassemia, 5 cases combined with β-thalassemia, and 1 case combined with α-thalassemia and β-thalassemia (Tables 4 and 5). We found that the abnormal hemoglobin content was correlated with the condition of complex thalassemia.

Figure 1. (A): The hemoglobin variant Hb Cibeles identified by Sanger sequencing. The arrow shows the mutation of the HBA2 gene (B): Hb Cibeles eluted in Z12 on the Capillarys 2 CE analyzer. The arrow shows the abnormal peak.

Figure 2. (A): The hemoglobin variant Hb J-Wenchang-Wuming identified by Sanger sequencing. The arrow shows the mutation of the HBA1 gene. (B): Hb J-Wenchang-Wuming eluted in Z12 on the Capillarys 2 CE analyzer. The arrow shows the abnormal peak.

Figure 3. (A): The hemoglobin variants Hb Ube-2 identified by Sanger sequencing. The arrow shows the mutation of the HBA1 gene (B): Hb Ube-2 eluted in Z12 on the Capillarys 2 CE analyzer. The arrow shows the abnormal peak.

Table 3. The distribution of rare hemoglobin variants.

Hemoglobin variants	HGVS	Amino acid	Case (n)	Distribution area
Hb Cibeles	HBA2:c.77G > A	Gly > Asp	1	Z12
Hb J-Broussais	HBA1:c.273G > T	Lys > Asn	1	Z6,Z12
Hb G-Honolulu	HBA2:c.91G > C	Glu > Gln	2	Z6,Z1
Hb J-Wenchang-Wuming	HBA1:c.34A > C	Lys > Gln	3	Z12
Hb Handsworth	HBA1:c.55G > C	Gly > Arg	4	Z5
Hb Ube-2	HBA1:c.205A > G	Asn > Asp	1	Z12
Hb Q-Thailand	HBA1:c.223G > C	Asp > Asn	12	Z7
Hb G-Siriraj	HBB:c.22G > A	Glu > Lys	1	Z6,Z11
Hb NewYork	HBB:c.341 T > A	Val > Glu	45	Z11
Hb Anti-Lepore Liuzhou	NG_000007.3:g.63154-70565dup	-	1	Z3
Total			71

Table 4. The hematologic phenotype of rare hemoglobin variation in the Hb Zone.

Hemoglobin variants type	Case(n)	RBC (10^12/L)	HB (g/L)	MCV (fl)	MCH (pg)	HB A2 (%)	Hb Zone (%)	Aera
α chain
Hb Cibeles	1	5.75	151	81.50	26.20	2.80	0.90	Z12
Hb J-Broussais with -α3.7/αα	1	4.92	143	89.80	29.10	1.80	29.10	Z6,Z12
Hb G-Honolulu	2	4.68 ± 0.40	145 ± 14	92.05 ± 0.15	30.43 ± 0.43	1.95 ± 0.25	23.6 ± 0.10	Z6,Z1
Hb J-Wenchang-Wuming	2	4.20 ± 0.73	143 ± 22	98.2 ± 0.70	32.55 ± 0.95	2.05 ± 0.15	37.25 ± 14.85	Z12
Hb J-Wenchang-Wuming with HBB: c.126_129delCTTT /WT	1	6.05	117	58.10	18.60	5.50	21.80	Z12
Hb Handsworth	4	5.63 ± 0.68	164 ± 13	87.45 ± 3.25	29.40 ± 1.20	2.15 ± 0.15	13.6 ± 0.5	Z5
Hb Ube-2	1	4.92	146	91.2	29.60	2.00	24.00	Z12
Hb Q-Thailand	1	5.32	145	83.10	28.20	2.6	17.60	Z7
Hb Q-Thailand with -α4.2/αα	10	5.51 ± 0.86	148 ± 16	81.55 ± 5.55	26.65 ± 2.05	2.25 ± 0.55	28.55 ± 0.95	Z7
Hb Q-Thailand with -α4.2/ HBA2: c.369G > C and HBB: c.−76A > G/WT	1	5.56	138	73.20	24.80	5.30	34.10	Z7
β chain
Hb G-Siriraj	1	7.07	158	70.7	22.4	4.40	11.10	Z6,Z11
Hb New York	34	4.97 ± 1.27	133 ± 33	84.5 ± 11.5	28.35 ± 3.75	2.55 ± 0.75	44.5 ± 2.5	Z11
Hb New York with –SEA/αα	6	6.83 ± 0.55	145 ± 8	67.45 ± 0.95	21.25 ± 0.55	2.6 ± 1.1	36.4 ± 0.6	Z11
Hb New York with -α3.7/αα	2	5.00 ± 0.11	137.5 ± 2.50	85.25 ± 0.75	27.85 ± 0.45	2.65 ± 1.5	39 ± 1.2	Z11
Hb New York with HBA2: c.427T > C/WT	1	4.55	116	77.90	25.40	2.70	40.00	Z11
Hb New York with HBB: c.316-197C > T/WT	2	5.35 ± 0.52	104 ± 1	62.2 ± 6.2	19.65 ± 1.85	4.75 ± 0.3	92.05 ± 1.45	Z11
Hb Anti-Lepore Liuzhou	1	6.44	137	65.9	21.2	16.5	-	Z3
Total	71

Table 5. Hemoglobin variation in the Hb Zone with thalassemia.

Distribution area	With α-thal	With β-thal	With α and β-thal
Z11	9	2	0
Z12	2	1	0
Z3	1	0	0
Z8	1	0	0
Z7	10	0	1
Z3	1	0	0
Z6、Z11	0	1	0
Z6、Z12	1	1	0
Total	25	5	1

3.3. Rare hemoglobin variant analysis by capillary electrophoresis and molecular diagnostic

Sanger sequencing and MLPA detection were performed on 81 samples with hemoglobin variants in the Hb Zone (Table 3), and rare hemoglobin variant Hb Cibeles was detected (Figure 1(A,B)), which was the first report in Asia; we found Hb J -Broussais, Hb G-Honolulu, and Hb J-Wenchang-Wuming, which were all first reported in Guangxi. We also found Hb Ube-2, Hb G-Siriraj, Handsworth, Hb Q-Thailand and Hb NewYork. 1 case of 7412 bp duplicate (hg38 CHR11:5,227,051-5,234,462) was identified by SMRT and named Hb Anti-Lepore Liuzhou (Figure 4(A,B)).

Figure 4. (A): The MLPA(P102) technique detects copy number variation. The proband had a duplicated copy, shown in the blue box region of the β-globin gene cluster. (B): SMRT results of the proband. The arrow shows a 7,412 bp duplicate (hg38 chr11:5,227,051-5,234,462) of the β-globin gene cluster.

3.4. Phenotype comparison of rare hemoglobin variants Hb Cibeles

Hematological phenotypes of Hb Cibeles detected in this study were compared with those in the previous literature (Table 6). There were significant differences in MCV, MCH and clinical manifestations between the two cases. Case 1 has micro-erythroemia and shows mild thalassemia, while the hematological parameters of Case 2 were critical, and only showed static thalassemia.

Table 6. Hematologic phenotype of Hb Cibeles carriers.

	Nationality	Age	Sex	HB (g/L)	MCV (fl)	MCH (pg)	RDW-CV (%)	Hb A2 (%)	Hb Zone (%)	Zone
case1	Ethiopian	4y	male	126	70.1	22.6	14.4	2.6	-	-
case2	China	36y	male	151	81.5	26.2	13.9	2.8	0.9	Z12

4. Discussion

Hemoglobinopathy is a kind of hereditary blood disease caused by an abnormal structure or insufficient synthesis of the globin chain. Studies have shown that when the structure of the peptide chain changes, unstable hemoglobin variants can be generated, leading to gene mutation transcription or post-transcription metabolic abnormalities, and the expression of the affected globin chain will decreases, resulting in thalassemia manifestations [13]. In this study, 174 cases of group J, K, Q, G and E hemoglobin variants were found by hemoglobin electrophoresis in Guizhong, Southern China, and the prevalence of hemoglobinopathy was 0.73% (174/23709), higher than that of Meizhou, Guangdong Province (0.477%) [14], Shaokwan, Guangdong Province (0.46%) [15] and Fujian Province (0.26%) [16]. We identified 71 cases of mutations in the Z zone, including 24 cases of α-globin chain hemoglobin variants (Hb Cibeles, Hb J-Broussais, Hb G-Honolulu, Hb J-Wenchang-Wuming, Hb Ube-2, Hb Handsworth, Hb Q-Thailand), and 47 cases of β-globin chain hemoglobin variants (Hb G-Siriraj, Hb NewYork, Hb Anti-Lepore Liuzhou).

We found that the mutation types of different regions in hemoglobin electrophoresis detection are different, and the mutation types of the same region may also be different (Table 3). A rare hemoglobin variant Hb Cibeles was detected in Z12 (Figure 2(A,B)). The molecular structure of Hb Cibeles is extremely unstable [17]. Hb Cibeles detected in our study are reported for the first time in Asia, and only an adopted Ethiopian 4-year-old male carrier reported in 2014 by Felix de la Fuente-Gonzalo [17]. They suggest that the tertiary structure of hemoglobin was affected by unstable Hb Cibeles, leading to the manifestations of nondeletion α-thalassemia. Comparing the hematological phenotypes of two cases (Table 6), we found that although they were both Hb Cibeles carriers, the Ethiopian male (Case 1) showed microcytosis and hipocromy [17]. While the male carrier in this study (Case 2) showed static α-thalassemia, with hematological indicators in critical value. Hemoglobin variant content (Hb Z) of about 0.9% was detected, and the manifestations are not as obvious as in Case 1. It may be related to individual differences and low Hemoglobin variant content, but according to the available data, intermediate or severe thalassemia may appear when Hb Cibeles is co-inherited with α-thalassemia. In this study, Hb J-Broussais co-inherited with static α-thalassemia -α^3.7/αα was detected, and its Hb Z was 29.1%. In the case of Hb J-Broussais co-inherited with β⁺ thalassemia [18], Hb Z was 19.4%, the comparison shows that there is a change in Hb Z. Hb J-Wenchang-Wuming, Hb J-Broussais, Hb Ube-2 were also detected in Z12. They cause a few hematological changes, which are consistent with the reported in previous literature [19,20]. Hemoglobin variants above were isolated in Z12. Previous studies also found that a variety of hemoglobin variants were detected in this zone [21,22], indicating that there may be rare hemoglobin variants when Z12 has an abnormal peak, which requires further molecular diagnosis. The hemoglobin variants detected in Z6 were Hb G-Honolulu and Hb G-Siriraj. Hb G-Honolulu was a stable hemoglobin variant. Although this variation affected the physical properties of hemoglobin, it did not change its function [23]. Hb G-Siriraj is a relatively stable hemoglobin, which is the change of external amino acid [24]. Literature shows that Hb G-Siriraj carriers usually have no manifestations [25,26]. The sample in this study(Hb 158 g/L, MCV 70.7 fl, MCH 22.4 pg, Hb A₂ 4.4%, Hb Z 11.1%) showed mild β-thalassemia, which was inconsistent with previous reports. Zeng [24] first reported a homozygous case of Hb G-Siriraj with microcytic hypochromic anemia. Sanger sequencing detected that the Hb G-Siriraj in this case was heterozygous, and no other HBB gene mutations were detected, so the possibility that homozygous can be ruled out, we need to collect pedigree to further exploration. It can be seen that although most Hb G-Siriraj carriers were normal, it is still necessary to be alert to the possibility of moderate and severe thalassemia in a fetus which is homozygous or when it is co-inherited with β-thalassemia.

Hemoglobin variants co-inherited with α-thalassemia and/or β-thalassemia are more common in Southern China, and it is Hb Z will also change with thalassemia (Tables 4 and 5). Hb Q-Thailand was detected in the Z7 region. In this study, the Hb Z of Hb Q-Thailand carriers was about 17.80%; When Hb Q-Thailand with -α^4.2/αα, the Hb Z was 28.55% and its hematological phenotype was critical, with static thalassemia phenotype. When Hb Q-Thailand with -α^4.2/HBA2: c.369G > C and HBB: c.−76A > G/WT, the Hb Z was 34.10%, showing mild thalassemia. 45 cases of Hb New York were detected in Z11. Hb Z of Hb New York carriers was about 44.5%, and their hematological phenotypes are variable. Some cases may have microcytic hypochromic anemia, which is due to the slight instability of Hb New York, which may have a slight impact on the physiological state of red blood cells [27]. Hb New York co-inherited with α-thalassemia had a Hb Z of 36-40%, and the abnormalities were consistent with a degree of thalassemia. When Hb New York co-inherited with mild β-thalassemia, Hb Z was 92.05%, and Hb A was not detected, indicating that there was no normal β-chain generated at this time. Since Hb New York still had a chemical function, the body only showed mild β-thalassemia although Hb Z was extremely elevated. Analysis of the data above can speculate that the Hb Z of carriers who co-inherited the same type of thalassemia is usually increased, which may be due to a further decrease in normal globin chain production, leading to the increase in abnormal hemoglobin. However, Hb Z decreased when co-inherited with a different type of thalassemia, and the more severe the thalassemia, the greater the change in Hb Z, which may be due to the proportion change of α- and β-globin chain.

One novel mutation was identified, which was named Hb Anti-Lepore Liuzhou (Figure 3(A,B)). We identified the location of structural variation by SMRT, HBB-anti-Lepore 7,412 bp duplicate (hg38 Chr11:5,227,051-5,234,462). It is the product of the unequal exchange of gene fusion between the β-chain and δ-chain. In general, the synthesis level of the β-δ fusion gene is much lower than that of a normal β-globin chain but much higher than that of a normal δ-globin chain [28]. The results of routine thalassemia gene detection of the samples in this study were –^SEA/αα, RBC 6.44*10^12/L, Hb 137 g/L, MCV 65.9fl, MCH 21.2pg, HbA₂ 16.5%, an abnormal peak appears in Z3. The peak of hemoglobin variant coincides with HbA₂. So far, previously reported Anti-Lepore variants include Hb Parchman, Hb Miyada, Hb P-India, Hb P-Congo, Hb Lincoln Park, Hb P-Nilotic and Hb anti-Lepore Hong Kong [29,30], most of them have normal hematological phenotypes, but only Hb Anti-Lepore Hong Kong (NG_000007.3:g.63160_70572dup) has elevated HbA₂ content caused by a high level of β- δ fusion gene expression[28,31]. However, it is not the same breakpoint as Hb Anti-Lepore Liuzhou. A study of So C C [31] showed that Hb Anti-Lepore Hong Kong’s globin gene was closely related to the 5′ locus control region (LCR) and gene expression degree. Hb anti-Lepore Hong Kong co-inherited with β⁰-thalassemia may lead to intermediate thalassemia. Considering that Hb Anti-Lepore Liuzhou may be similar to Hb anti-Lepore Hong Kong in gene expression, we should pay attention to prenatal diagnosis.

There are some limitations in this study, some of the newly discovered rare hemoglobin variants could not be analyzed by pedigree, and more cases need to be collected for the follow-up study.

In this study, 15 regions divided by hemoglobin electrophoresis were classified. 1 new hemoglobin variant, Hb Anti-Lepore Liuzhou, and 9 rare hemoglobin variants were discovered and found in Z1-Z12. It is worth noting that although most of the hemoglobin variants have normal hematological phenotypes, we found that Hb Cibeles and Hb G-Siriraj have different hematological phenotypes from previous studies, when they co-inherited with thalassemia may lead to moderate or severe anemia. More data should be collected for further research. We found that some hemoglobin variants may affect other indicators, and we need to screen them in daily detection work. This study deepened our understanding of co-inheritance between hemoglobin variants and thalassemia and provided important data support for prenatal counseling and prenatal diagnosis by analyzing hemoglobin variants.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Additional information

Funding

This work was supported by the Scientific Research Fund of the Health and Family Planning Commission of Guangxi Zhuang Autonomous Region [grant numbers Z20170528 and Z-B20221578], Guangxi Science and Technology Plan Project (Guangxi Clinical Research Center for Obstetrics and Gynecology, GuiKe AD22035223), Liuzhou Science Technology Innovation Capability and Conditions Construction Project [grant number 2018AF10501], Key Research and Development Program of Guangxi [grant number Guike AB18126056], Key Research and Development Program of Liuzhou [grant number 2018BJ10301], Scientific Research and Technology Development Project of Liuzhou [grant numbers 2018DB20501 and 2022SB024], Guangxi medical high-level backbone talents ‘139’ plan training target special [grant number G202003028], Liuzhou city 1/10/100 talent special project and Guangxi Key Research and Development Project [grant number 2021AB12015].