The effects of oregano essential oil on production performance and intestinal barrier function in growing Hyla rabbits

Abstract

The purpose of this study was to investigate the effects of oregano essential oil on the production performance and intestinal barrier in rabbits. One hundred and ninety-two weaned Hyla rabbits (35 days old) with similar body weight (1268.5 ± 25 g) were randomly divided into four groups (24 replicates per group, two rabbits per replicate): fed a basal diet (Control group), fed a basal diet containing 0.02% oregano essential oil (LO group, the purity of oregano essential oil was 5%), fed a basal diet containing 0.04% oregano essential oil (MO group), or fed a basal diet containing 0.08% oregano essential oil (HO group). The trial included 7 days of adaptation and 23 days of testing. Although dietary addition of oregano essential oil did not affect significantly the average daily body weight and final body weight (p > .05), dietary addition of 0.08% oregano essential oil decreased significantly feed intake and diarrhoea rate of the rabbits (p < .05). When the addition of oregano essential oil in the feed reached 0.08%, the Villus high/Crypt depth value in the ileum of meat rabbits increased significantly (p < .05). Dietary addition of 0.08% oregano essential oil increased significantly the gene expression of junctional adhesion molecule 2 (JAM2) and JAM3 in jejunum (p < .05). The content of interleukin-2 (IL-2) and immunoglobulin A (SIgA) in jejunum and IL-10 and secretory immunoglobulin G (SIgG) in ileum were significantly increased after the addition of 0.08% oregano essential oil compared with the control (p < .05). In conclusion, a dietary supplement of oregano essential oil modulates immune responses and enhances the intestinal barrier. Besides, our experiment offers positive evidence in improving rabbit health of oregano essential oil instead of antibiotics.

HIGHLIGHTS

• Oregano essential oil can improve the production performance of rabbits.

• Oregano essential oil improved intestinal barrier function in rabbits.

• Oregano essential oil can be used as a new additive in rabbit feed.

Keywords:

• Organo essential oil
• rabbits
• growth performance
• intestinal development
• differentially expressed genes

Introduction

In rabbit production, intestinal problems caused by early weaning are one of the main causes of diarrhoea and death of rabbits (Liu et al. 2019). To reduce diarrhoea and mortality in livestock production, farmers often add antibiotics to their feed. With the extensive use of antibiotics, bacterial pathogens have developed drug resistance. It is also an important problem for researchers to maintain the intestinal health of livestock and poultry without antibiotics (Cervantes 2015). So animal husbandry researchers want to use additives that can replace antibiotics.

Oregano (Origanum vulgare) is a phytobiotic and is known to contain antimicrobial compounds, such as carvacrol, thymol, and their precursors, p-cymene and γ-terpinene, generally equating to 80% of essential oil contents (Brenes and Roura 2010). Oregano essential oil has a more positive effect on animal growth and health than oregano powder (Puvača et al. 2013). Because of their antibacterial, anti-inflammatory, and antioxidant properties, plant essential oils have been widely used to improve health or treat human diseases (Kim et al. 2008; Faith et al. 2018). Schmidt et al. (2009) studied the chemical constituents of oregano essential oil by GC, FID, and GC-MS, which are mainly composed of geraniol, carvol, thymol, β-caryophyllene, and so on. And carvacrol and thymol are the most important active material, which has significant antibacterial and antioxidant effects. The antibacterial activity of oregano essential oil has been reported in the previous literature (Figen et al. 2011). Oregano essential oil has been shown to have an inhibitory effect on Escherichia coli, Staphylococcus aureus, and Salmonella typhimurium (Friedman et al. 2002; Oussalah et al. 2007). Botsoglou et al. (2002) found that the addition of oregano essential oil in the diet reduced the malondialdehyde content in broiler meat. Li et al. (2012) found that the dietary addition of plant essential oils could reduce the diarrhoea rate in weaned piglets and the number of intestinal Escherichia coli. Hong et al. (2012) found that adding plant essential oils to the diet could increase the height of duodenal villi in broilers. Cheng et al. (2018) found that the addition of oregano essential oil to the diet could regulate the intestinal flora structure and improve the intestinal morphology of pigs. Cardinali et al. (2015) found that oregano improved production performance and feed conversion ratio in rabbits.

Currently, oregano essential oil is much studied in pigs and poultry, but less so in rabbits. In this experiment, we mainly studied the effects of oregano essential oil on the production performance and intestinal development of weaned meat rabbits. For the production performance, we tested the average daily feed intake (ADFI), average daily gain (ADG), feed-to-gain ratio (F/G), death rate, and diarrhoea rate of rabbits to determine the optimal amount of oregano oil to be added to rabbit farming and to conduct the next test. For the test of intestinal development, we selected the oregano essential oil adding group with better production performance and the control group to detect the intestinal morphology, intestinal barrier-related gene expression, and cytokine and immunoglobulin levels. The final results are useful to identify the efficacy and safety of oregano essential oil in the rabbit diet.

Materials and methods

Animal diet, management, and experimental design

In this experiment, 192 weaned healthy Hyla rabbits (male-female ratio of 1:1, and the rabbits were 35 days old) with similar body weight (1268.5 ± 25 g) were divided into four groups (24 replicates per group, two rabbits per replicate): fed a basal diet (control) or fed, respectively, an experimental diet with the supplement of 0.02% (LO group), 0.04% (MO), or 0.08% (HO) oregano essential oil (Dosto Farm, Germany). The main components of oregano essential oil are shown in Table 1. Oregano essential oil was sprayed on a carrier and added to the diet in the final purity of 5%. all rabbits were fed twice a day (8:00 and 16:00). The experiment lasted for 30 days which included 7 days adaptation period and 23 days experimental period. Temperature and lighting were maintained according to commercial conditions. The ingredients and composition of the diet are listed in Table 2. All rabbits had free access to feed and water during the rearing period. During the experiment, the feed intake and body weight of rabbits were recorded.

Table 1. The main components of oregano essential oil in this experiment.

Component	Content, %
Carvacrol	60.00
P-Cymen	5.00
Gamma-Terminen	4.00
Thymol	1.00
Beta-caryophyllen	2.00
Linalool	5.00
Alpha-Terpinen	1.50
Terpinen-4-ol	2.00
Trans-Sabinenhydrate	0.30

Table 2. Composition and nutrient levels of basal diets (air-dry basis).

Item	Content, %	Item	Content
Ingredients		Nutrient level^b
Corn	13.3	DM	84.49
Soybean meal	13	CP	16.24
Wheat bran	19	EE	3.11
Corn Germ	19	CF	15.44
Alfalfa	12	NDF	36.14
Soya	19	ADF	19.11
Bean oil	0.7	Ca	0.42
Premix^a	4	P	0.42
Total	100

DM: dry matter; CP: crude protein; EE: ether extract; CF: crude fibre; NDF: neutral detergent fibre; ADF: acid detergent fibre; Ca: calcium; P: phosphorus.

^aThe premix provided the following per kg of diet: VA 12,000 IU, VD3 9000 IU, VE 50 mg, VK31.5 mg, VB11.5 mg, VB2 25 mg,VB3 40 mg,VB5 50 mg, VB6 0.5 mg, VB11 2.5 mg, VB12 0.02 mg, cholinechloride 600 mg, biotin 0.2 mg, K 7 mg, Mg 3 mg, Fe 60 mg, Zn 60 mg, Cu 40 mg, Mn 9 mg, I 1 mg, Se 0.2 mg, Iimestone 15,000 mg, NaCl 5000 mg, Lys 1000 mg, Met 2000 mg. The rest was miscellaneousmeal carrier complement.

^bNutrient levels were measured values.

Sample collection and preparation

At the end of the experiment, nine rabbits with fasting for 12 h from each group (the weight of each rabbit was close to the average weight of the corresponding group) were euthanized. We collected four copies of jejunum and ileum from each rabbit, two of which were fixed with 4% paraformaldehyde-fixed solution for 24 h, replaced with fresh 4% paraformaldehyde 24 h later, and then replaced with fresh 4% paraformaldehyde every 7 days. The fixed tissue was used to create intestinal tissue sections to observe intestinal morphological changes. The other two pieces were collected in tubes and placed in liquid nitrogen, and then stored at −80 °C. Two samples of the caecal contents were collected from each rabbit into 5 mL cryopreservation tubes, placed in liquid nitrogen, and then preserved at −80 °C until intestinal flora analysis.

Analysis of production performance

Average daily feed intake (ADFI) = Total feed intake per rabbit during normal feeding/Test days

Average daily gain (ADG) = {Final body weight (FBW) − Initial body weight (IBW)}/Test days

Death rate = Number of death rabbits/Total number of rabbits in each group*100%

Diarrhoea rate = Number of diarrhoea rabbits/Total number of rabbits in each group*100%

F/G = ADFI/ADG

After the rabbits were slaughtered, the head, bleed, skin, removed the stomach, intestines, lungs, trachea, spleen, pancreas and reproductive organs were removed, and the left body with heart, liver, and kidneys was weighted (half-bore weight). Afterwards, the heart, liver, and kidneys were removed and weighed (full-bore weight). After that, we calculated the half-bore rate and the full-bore rate.

Half-bore rate = Half-bore weight/pre-slaughter weight

Full-bore rate = Full-bore weight/pre-slaughter weight

Analysis of intestinal morphology

After the rabbits were slaughtered, the tissues of the duodenum, jejunum, and ileum were collected from each rabbit. The samples were processed, embedded, and stained according to the procedures of Liu et al. (2019). Afterwards, the height of the villus and the depth of the crypt were observed under the microscope.

Analysis of intestinal physical barrier

The samples of jejunum and ileum were collected for the detection of the intestinal physical barrier and the expression of intestinal tight junction-related genes. We extracted the total RNA, from intestinal tissue by the Trizol method, then reverse transcribed it with the kit provided by Beijing TransGen Biology Co., Ltd. (Beijing, China), and finally got cDNA (Li et al. 2020). After that, we used the kit provided by the Hunan Accurate Biological Co., Ltd. (Hunan, China) for RT-PCR (Fu et al. 2017; Liu et al. 2017). Finally, we used 2^−ΔΔCt method to calculate the expression of related genes. The mRNA levels of the target genes were normalised to that of β-actin (Wang et al. 2017; Zhu et al. 2017). The sequences of the primers used in the experiment are shown in Table 3. And the instrument of RT-PCR is Swiss Roche LightCycler 96.

Table 3. Gene-specific primers used for the analysis of rabbit gene expression.

Gene	Genebank accession number	Primers sequences (5′→3′)	Product size, bp
β-actin	NM_001101683.1	F:CGCAGAAACGAGACGAGATT	168
		R:GCAGAACTTTGGGGACTTTG
Occludin	XM_008262318	F: CTTGCCTGGGACAGAACCTA	121
		R: AGCCATAACCGTAGCCGTAA
Claudin	NM_001089316.1	F:GGAGCAAAAGATGCGGATGG	93
		R:AATTGACAGGGGTCAAAGGGT
ZO-1	XM_008269782.1	F: GACTGATGCGAAGACGTTGA	117
		R: GCAGAATGGATGCTGTCAGA
ZO-2	XM_017341705.1	F: CAGCAAGGAGAGGCAGTGTG	119
		R: CGGCTGTCGCAACTCAGATA
JAM2	XM_017346699.1	F: ATATCGCAGGTGTCCTGGAA	122
		R: GAGCATAGCACACGCCAAG
JAM3	XM_008248362.2	F: TGTGAGGAGCAGGAGATGGA	123
		R: GCCACGTCTGTATGCACAGC
Muc1	L41544.1	F: TATACCGCAAGCAGCCAGGT	135
		R: GCAAGCAGGACACAGACCAG
Muc4	XM_017347029.1	F:TCCTCCAGTCACCTCAGCAG	121
		R: GCTGGTTGGAGATCCTCTGG

ZO-1: Zonula occludens 1; ZO-2: Zonula occludens 2; JAM2: junctional adhesion molecule 2; JAM3: junctional adhesion molecule 3; Muc1: Mucorprotein 1; Muc4: Mucorprotein4.

Analysis of intestinal immune barrier

After the rabbits were slaughtered, the jejunum and ileum were placed in 1.5 mL cryopreservation tubes, and stored at −80 °C. The contents of interleukin-2 (IL-2), interleukin-10 (IL-10), secretory immunoglobulin A (SIgA), secretory immunoglobulin G (SIgG), and tumour necrosis factor-α (TNF-α) in the jejunum and ileum were measured in samples from each group. The detection method is carried out according to the method of Li et al. (2020). The Elisa kits were provided by Shanghai Hengyuan Biological Co., Ltd. (Shanghai, China).

Statistical analysis

Data were analysed with the generalised linear model (GLM) one-way analysis of variance test using the SAS (Version 8e, SAS Institute, Cary, NC, USA) statistical software package (for production performance analysis, n = 24; for slaughter performance, intestinal morphology, gene expression, cytokine and immunoglobulin levels analysis, n = 9), followed by Duncan’s multiple range test to compare differences among treatments when significant differences (p < .05) were observed. And we used GraphPad Prism (GraphPad Software Inc., CA, USA) to graph the data.

Result

Effect of oregano essential oil on production performance and slaughter performance

The effect of oregano essential oil on the growth performance of rabbits is shown in Table 4. When the addition of oregano essential oil reached 0.08%, the F/G of meat rabbits reached the lowest level, at 3.61 (p < .05). The diarrhoea rate was significantly decreased (p < .05). Based on the F/G and diarrhoea rate, we chose the control group and HO group for the next experiment.

Table 4. Effect of oregano essential oil on production performance of rabbits.

Item	Dietary oregano essential oil added levels, %				R-MSE	p-Value
	Control	LO	MO	HO
IBW, g	1266.90	1264.55	1270.91	1274.46	187.93	.9982
FBW, g	2432.86	2510.00	2400.93	2481.96	289.68	.6004
ADG^a, g/d	31.51	33.66	30.54	32.64	6.14	.3673
ADFI^b, g/d	126.67^ab	128.97^a	118.50^ab	115.37^b	18.40	.0474
F/G^c	4.22^a	3.85^ab	4.00^ab	3.61^b	0.85	.1213
Diarrhoea rate, %	43.75	25.00	56.25	31.25	30.78	.0035
Death rate, %	29.17	22.92	25.00	20.83	31.11	.8153

IBW: initial body weight; FBW: final body weight; ADFI: average daily feed intake; ADG: average daily gain.

Oregano essential oil was added at 0.00% in the Control group; 0.02% in the LO group; 0.04% in the MO group; and 0.08% in the HO group.

Means within lines with different superscript letters are significantly different (p < .05).

^aADG = (FBW − IBW)/Test days.

^bADFI = Total feed intake per rabbit during normal feeding/Test days.

^cF/G = ADFI/ADG.

The effect of oregano essential oil on the slaughter performance of rabbits is shown in Table 5. The addition of oregano essential oil to the feed had no significant effect on all slaughter performance indexes of rabbits (p > .05).

Table 5. Effect of oregano essential oil on slaughter performance of rabbits.

Item	Control	HO	R-MSE	p-Value
Pre-slaughter weight, g	2384.00	2385.56	0.98	.9883
Full-bore weight, g	1100.89	1152.78	156.24	.4913
Half-bore weight, g	1195.56	1242.22	163.72	.5539
Full-bore rate, %	46.03	48.19	2.94	.1385
Half-bore rate, %	50.02	51.94	3.08	.2045

Full-bore rate = Full-bore weight/Pre-slaughter weight.

Half-bore rate = Half-bore weight/Pre-slaughter weight.

Effect of oregano essential oil on intestinal morphology

The effect of oregano essential oil on the intestinal morphology of rabbits is shown in Table 6. After adding oregano essential oil to the diet, for the jejunum and the ileum, there was no significant difference in villi heights and crypt depth in duodenum, jejunum, and ileum (p > .05). Although the dietary adding of oregano essential oil did not affect significantly the V/C value in the duodenum and jejunum, increased significantly the V/C value in the ileum (rising by 1.3, p < .05).

Table 6. Effect of oregano essential oil on intestinal morphology of rabbits.

Item	Control	HO	R-MSE	p-Value
Duodenum
Villus high, um	847.33	852.67	82.6542	.9408
Crypt depth, um	184.50	183.00	8.3964	.8375
V/C	4.59	4.68	0.5252	.8384
Jejunum
Villus high, um	756.00	822.37	67.8903	.5627
Crypt depth, um	154.50	186.87	20.7553	.0695
V/C	4.95	4.57	0.709	.4772
Ileum
Villus high, um	526.28	548.67	40.9694	.5399
Crypt depth, um	178.33	133.67	28.175	.1241
V/C	2.96^b	4.25^a	0.5559	.0471

V/C: Villus high/Crypt depth.

Means within lines with different superscript letters are significantly different (P<0.05).

Effect of oregano essential oil on intestinal physical barrier

The effect of oregano essential oil on the intestinal physical barrier of rabbits is shown in Figure 1. We detected the gene expression of Occludin, Claudin-1, Zonula occludens 1 (ZO-1), Zonula occludens 2 (ZO-2), Junctional adhesion molecule 2 (JAM2), Junctional adhesion molecule 3 (JAM3), Mucoprotein 1 (MUC1), and Mucoprotein 4 (MUC4) in jejunum and ileum. In jejunum, the addition of 0.08% oregano essential oil increased significantly the gene expression of JAM2 and JAM3 (P_JAM2 = 0.0049, P_JAM3 = 0.0494). But there was no significant effect for the ileum. Dietary addition of 0.08% oregano essential oil had no significant effect on the gene expression of Occludin, Claudin-1, ZO-1, ZO-2, MUC1, and MUC4 in jejunum and ileum (p > .05).

Figure 1. Effect of oregano essential oil on the expression of intestinal barrier related genes [Jejunum (A), Ileum (B)]. ZO-1: zonula occludens 1; ZO-2: zonula occludens 2; JAM2: junctional adhesion molecule 2; JAM3: junctional adhesion molecule 3; Muc1: mucorprotein 1; Muc4: mucorprotein 4. ^a,bMeans with different superscripts are significantly different (p < .05).

Effect of oregano essential oil on intestinal immune barrier

The detection results of intestinal immune barrier indicators were shown in Figure 2. The content of IL-2 and SIgA in the jejunum and IL-10 and SIgG in the ileum were significantly increased after the addition of 0.08% oregano essential oil compared with the control (p < .05). Dietary addition of 0.08% oregano essential oil had no significant effect on the content of IL-10, SIgG, TNF-α in the jejunum and IL-2, SIgA, and TNF-α in the ileum (p > .05).

Figure 2. Effect of oregano essential oil on intestinal immune barrier [IL-2 (A), IL-10 (B), SIgA (C), SIgG (D), TNF-α (E)]. IL-2: interleukin-2; IL-10: interleukin-10; SIgA: secretory immunoglobulin A; SigG: secretory immunoglobulin G; TNF-α: tumour necrosis factor-α. ^a,bMeans with different superscripts are significantly different (p < 0.05).

Discussion

Oregano essential oil improved the production performance

Weaning can be a difficult process for rabbit breeding. Weaning could induce diarrhoea and low production performance in rabbits. Alleviating weaning stress is one of the important prerequisites for improving rabbit production performance (Campbell et al. 2013). There have been many reports about the effect of oregano essential oil on animal production performance. Hertrampf (2001) found that adding 399 mg/t oregano essential oil to drinking water could improve the performance of broilers. Figen et al. (2011) found that the dietary addition of oregano essential oil decreased the feed intake of broilers. In our experiment, dietary addition of oregano essential oil increased the feed conversion efficiency. Allan and Bilkei (2005) found that adding oregano essential oil to the diet of breeding sows could significantly increase the litter yield of sows and the survival number of piglets, and reduce mortality. In our experiment, the death rate and diarrhoea rate of meat rabbits were decreased significantly when dietary addition of oregano essential oil. However, when the addition of oregano essential oil reached 0.04%, the diarrhoea rate of meat rabbits reached 56.25%, which was higher than that of the other three groups. According to the index of production performance of meat rabbits, when the addition of oregano essential oil was 0.08%, the F/G ratio of meat rabbits decreased to the lowest level (p < .05), and the death rate and diarrhoea rate were also decreased compared with the control group. The better production performance may be caused by the enhancement of intestinal function by oregano essential oil, so we selected the control group and HO group for the next experiment.

Slaughter performance is an important indicator to judge the growth and development of animals, which has an important impact on the economic efficiency of the farming industry. The improvement of slaughter performance depends mainly on the increase of growth performance, the proportion of muscle, and the reduction of abdominal fat (Musa et al. 2006). In the previous study, the slaughter rate and full-bore rate of broiler chickens were increased after the dietary addition of oregano essential oil (Peng et al. 2016). According to the study by Khattak et al. (2014), the addition of a natural blend of essential oils to broiler diets increased carcase weight as well as breast weight of broilers. The addition of oregano essential oil to the diet increased carcase weight and improve meat quality in goats (Lei et al. 2018). However, there were also opposite results. The addition of 300 mg/kg of oregano essential oil to broiler diets had no effect on broiler carcase weight (Alp et al. 2012), which is similar to our present result indicating that the dietary addition of 0.08% oregano essential oil had no significant effect on the half-bore weight and full-bore weight in weaned meat rabbits. The reason for this differential effect of oregano essential oil on slaughter performance maybe related to the level of oregano essential oil addition, feeding environment, type of diet, and hygiene (Amad et al. 2011).

Oregano essential oil improved the intestinal morphology

Villus height, crypt depth, and V/C value are important indicators of intestinal health (Qaisrani et al. 2014). In livestock, early weaning leads to intestinal mucosal damage, characterised by reduced villus height and deepened crypt (Hu et al. 2013). The decrease of V/C value represents the decrease of intestinal absorption function and may lead to diarrhoea, while the increase of V/C value represents the increase of intestinal absorption area and absorption capacity (Li et al. 2012). In this experiment, dietary addition of oregano essential oil significantly increased the V/C value of ileum of meat rabbits but had no significant effect on the V/C value of the duodenum and jejunum. Similar results have been obtained in the experiments of Peng et al. (2016). These results suggest that oregano essential oil can increase the intestinal absorption area.

Oregano essential oil improved the intestinal barrier

The intestinal barrier mainly includes the physical barrier, chemical barrier, immune barrier, and biological barrier. In terms of the intestinal physical barrier, intestinal mucosal permeability is an important aspect of the intestinal physical barrier, which is closely related to tight junction proteins in the intestinal tract. It is reported that JAM belongs to the immunoglobulin superfamily, which not only participates in the tight junction structure of the intestinal tract but also acts as a ligand of lymphocyte function-associated antigen-1 (LFA-1). In this experiment, oregano essential oil could affect the physical barrier of rabbits jejunum via increasing the expression of JAM2 and JAM3 genes.

IL-2, known as the T cell growth factor, plays an important role in immunity. It can stimulate the proliferation and differentiation of T cells and B cells, and induce the secretion of interferon and other cytokines (Atkins et al. 2000). In this experiment, the content of IL-2 in rabbit jejunum increased significantly after the dietary addition of oregano essential oil, indicating that oregano essential oil increases the immunity of jejunum to some extent.

It has been shown that IL-10 is associated with intestinal diseases. IL-10 can help the animal organism to effectively defend against intestinal inflammation (Kole and Maloy 2014). IL-10 is mainly derived from monocytes, T cells, and B cells (Maynard and Weaver 2008), and is an important immunomodulatory factor with a strong limiting effect on the inflammatory response (Ashwini et al. 2016). Increased IL-10 levels could inhibit the production of IFN-γ, IL-1, IL-12, and TNF (Ashwini et al. 2016). In the previous study, Carvacrol (the main component of oregano essential oil) has potential anti-inflammatory and anti-nociceptive effects (Damasceno et al. 2014). In this test, the content of IL-10 in rabbit ileum was significantly increased in the HO group, but oregano essential oil had no effect on the content of TNF-α. In the jejunum, there was a slight increase in IL-10 content and a decrease in TNF-α content in the HO group (non-significant difference). These results imply that oregano essential oil could regulate the IL-10 secretion to affect the immune response in rabbit gut.

In addition, SIgA and SIgG have important regulatory roles in gastrointestinal mucosal immunity (Iijima et al. 2001). SIgA constitutes a major mucosal immune effector and provides an important first line of defence against pathogens. SIgG could promote immune cells to swallow pathogens and neutralise bacterial toxins. The content of SIgA in jejunum and SIgG in ileum were increased by the addition of oregano essential oil to rabbit feed, which indicates oregano essential oil could increase the ability to swallow pathogens and toxins, improve the ability of anti-disease and anti-inflammatory, and then enhance the immune function and promote intestinal health.

Conclusions

In conclusion, a dietary supplement of oregano essential oil modulated immune responses via increasing the secretion of IL-2, IL-10, SIgA, and SIgG and improved intestinal barrier by regulating JAM2 and JAM3 genes expression. These may be the cause of the low death rate and diarrhoea rate of weaned rabbits, so our experiment offered positive evidence of oregano essential oil instead of antibiotics.

Ethical approval

All study procedures were approved by the Shandong Agriculture University Animal Care and Use Committee (SDAUA-2015-011) and were conducted in accordance with the Guidelines for Experimental Animals established by the Ministry of Science and Technology (Beijing, China).

Acknowledgements

Thank you to all those who contributed to this experiment.

Disclosure statement

The authors declare that they have no competing interests.

Data availability statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Additional information

Funding

This work was supported by the Natural Science Foundation of Shandong Province (ZR202102200454), Modern Agro-industry Technology Research System (CARS-43-B-1), Modern Agro-industry Technology Research System of Shandong Province (SDAIT-21-16), National Natural Science Foundation of China (31972594), Taishan Industry Leadership Project (TSCY20190107), Industrial Upgrading Project of Agricultural Science and Technology Park of Shandong Province (2019YQ008), and Key Research and development project of Xinjiang (2020B01004-1-3).