Heat stress exposure changed liver lipid metabolism and abdominal fat deposition in broilers

Abstract

To evaluate the effects of heat stress on lipid metabolism in the liver and abdominal adipose deposition in broilers, totally, 120 female 21-day old broilers were selected and randomly allocated to 2 groups with 6 replication and 10 broilers per each replication. Broilers in the control group (CON) were reared at 24 °C, and broilers in the heat stress group (HS) were reared at 34 °C. Heat stress exposure increased (P < 0.05) rectal temperature, relative weight of abdominal adipose and liver, serum triacylglycerol (TG) and total cholesterol (TC) level, liver TG, TC, and very low-density lipoprotein (VLDL) content. Hepatic mRNA expression level of fatty acid synthase (FAS), acetyl-coenzyme A carboxylase (ACC), and abdominal adipose mRNA expression level of ACC and CCAAT/enhancer-binding protein-α (C/EBPα) were up-regulated (P < 0.05) when compared with the CON group. Heat stress exposure increased serum and hepatic TC and TG content, up-regulated the mRNA expression of FAS and ACC in liver, and promoted preadipocytes differentiation by increasing C/EBPα mRNA expression in abdominal adipose. Therefore, heat stress exposure increased abdominal adipose deposition, which related to increase in hepatic de novo lipogenesis, and promoted preadipocytes differentiation in abdominal adipose.

HIGHLIGHTS

• Heat stress increased abdominal adipose deposition

• Heat stress increased hepatic de novo lipogenesis

• Heat stress promoted preadipocytes differentiation in abdominal adipose

Keywords:

• Broiler
• heat stress
• liver
• lipid metabolism
• abdominal adipose deposition

Introduction

Heat stress was one of the main environmental stressors in poultry industry. In modern poultry industry, the genetic selection and commercial production for fast growth rate and feed efficiency, making broilers more sensitive to high temperature (Attia et al. 2017; Attia and Hassan 2017; Attia et al. 2018). Heat stress induced detrimental effects on feed intake and feed utilisation, disturbing intestinal and immune function, inducing endocrine disorder and oxidative damage, leading to poor growth performance (Farag and Alagawany 2018; Gonzalez-Rivas et al. 2020; Wasti et al. 2020; Kikusato et al. 2021; Olugbenga et al. 2022; Park et al. 2022). Meanwhile, heat stress response also involved in lipid metabolism. The lipid content in the intramuscular, subcutaneous, and abdominal adipose tissue of broilers increased under heat stress condition (Lu et al. 2007; Zhang et al. 2012; De Antonio et al. 2017; Lu et al. 2019). The excessive fat deposition was a negative phenomenon for economic benefit in poultry industry due to reduce feed efficiency and carcase yield, affected consumers’ acceptance, enhanced the processing fee for adipose discarding, and even polluted the environment (Fouad and El-Senousey 2014; Han et al. 2016; Moreira et al. 2018; Liu et al. 2019).

Liver was the main site of de novo lipogenesis (DL) in broilers, and synthesised over 90% fatty acids, while adipose tissue served as a fat storage site (Laliotis et al. 2010). The synthesised fatty acids were incorporated into triacylglycerol (TG) and assembled into very-low density lipoprotein (VLDL), then ferry to other tissues for energy supply or storage (Emami et al. 2020). Meanwhile, VLDL played a critical role in TG transportation to extra-hepatic tissues. Thus, hepatic lipid metabolism was closely related to TG accumulation in abdominal fat. Therefore, the increased fat deposition of heat stress exposure broilers may result in increasing hepatic DL and TG exportation to extra-hepatic tissues. Former literatures indicated that liver was responsive and susceptible to heat stress and changed the hepatic lipid metabolism (Faylon et al. 2015; Tang et al. 2015; Flees et al. 2017; Jastrebski et al. 2017). Meanwhile, literatures also illustrated that heat stress increased the level of TG and VLDL in serum and liver, as well as mRNA expression level of fatty acid synthase related genes (Lu et al. 2019). Heat stress increased fat deposition in broilers, but the relationship between heat stress and lipid metabolism in the liver and abdominal adipose tissue were poorly understood. Therefore, we hypothesised that heat stress increased abdominal adipose deposition by up-regulating hepatic DL in broilers. The aim of this study was to evaluate the effects of heat stress on lipid metabolism in the liver and abdominal adipose deposition in broilers.

Materials and methods

Animals and diets

A total of 120 one-day old female Arbour broilers were provided by a local commercial hatchery and the diet was formulated to meet or exceed the nutritional requirements of broilers during starter (day 1–21) and grower (day 22–42) phases, according to the NRC (1994) recommendations (Table 1). The temperature was maintained at 33 ± 1 °C for the first week. From day 8, the temperature was gradually reduced by 0.5 °C per day until maintained at 24 °C. Artificial light was provided 23 h/d by fluorescent lights. On day 21, 120 broilers were randomly selected and allocated to 2 groups with 6 replication and 10 broilers of each replication. Broilers in the control group (CON) reared at 24 °C, and broilers in the heat stress group (HS) reared at 34 °C, all broilers were ad libitum accessed to water and commercial feed diet. On day 1, 7, 14, and 21, two broilers were randomly selected from each pen to measure the rectal temperature at 9:00.

Table 1. Ingredient composition and nutrient content of diets.

Item^a	Starter (day 1–21)	Grower (day 22–42)
Ingredients, %
Corn	43.42	49.12
Wheat	20.00	20.00
Soybean meal, 44% CP	21.75	18.33
Corn gluten meal, 65% CP	5.00	3.72
Meal and bone meal, 50% CP	2.83	2.40
Tallow	4.44	4.42
Limestone	1.10	1.11
Salt	0.16	0.15
L-Lys·HCl (78.4%)	0.30	0.24
DL-Met, 88%	0.20	0.18
Thr, 98.5%	0.05	0.03
Vitamin premix^b	0.20	0.20
Mineral premix^c	0.10	0.10
Calculated composition
ME, Kcal/kg	3190	3210
Analysed composition, %
CP	21.12	19.79
Lys	1.19	1.02
Met + Lys	0.93	0.82
Ca	0.90	0.85
Total P	0.52	0.49

^a CP, crude protein; HCl, hydrochloric acid; DL-Met, DL-methionine; Thr, threonine; ME, metabolic energy; Lys, lysine; Ca, calcium; Total P, total phosphorus.

^b Provided per kilogram of complete diet: 12,8000 IU vitamin A, 1,600 IU vitamin D₃, 60 IU vitamin E, 1.6 mg vitamin K₃, 0.12 mg biotin, 50 mg choline, 1.2 mg folic acid, 32 mg Nicotinic acid, 16 mg pantothenic acid, 4.8 mg riboflavin, 2.4 mg thiamine (B₁), 3.2 mg vitamin B₆, and 0.03 mg vitamin B₁₂.

^cProvided per kilogram of diet: Mg, 79 mg as manganese oxide; Zn, 60 mg as zinc oxide; Cu,100mg as copper sulphate; Fe, 120 mg as iron sulphate; I, 0.96 mg as potassium iodine; Co, 0.16 mg as cobalt sulphate and Se, 0.24 mg as sodium selenite.

Growth performance

On day 21 and 42, body weight and feed intake were recorded as pen-basis to calculate average daily gain (ADG), average daily feed intake (ADFI), and feed conversion ratio (FCR).

Sample collection

On day 42, one broiler was randomly selected from each pen. After body weight check, blood samples were collected from the wing vein, and serum were separated for later analysis of TG, total cholesterol (TC), VLDL, low density lipoprotein (LDL), high density lipoprotein (HDL). Then, broilers were sacrificed, and the abdominal adipose and liver were isolated and weighted to calculated the relative weight of abdominal adipose and liver. Finally, abdominal adipose and liver samples were collected, freeze in lipid nitrogen, and stored at −80 °C for later analysis of hepatic TC, TG, VLDL, LDL, and HDL content, as well as gene expression.

Blood and liver TC, TG, VLDL, LDL, and HDL assay

The content of TC (A111-1-1), TG (A110-1-1), VLDL (H249), LDL (A113-1-1), and HDL (A112-1-1) in serum and liver were measured using commercial kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) followed the kits instruction.

Gene expression

Total RNA extraction, cDNA synthesis, and real-time quantitative polymerase chain reaction (RT-PCR) were followed the methods described by Lan et al. (2014), and the relative gene expression was calculated using the 2^-ΔΔCt method (Livak and Schmittgen 2001). The primer sequences were listed in Table 2.

Table 2. Primers for real-time PCR.

Gene^a	ACCession NO.	Primer sequence (5’ to 3’)	Product size (bp)
β-actin	NM_205518.1	F: ATCCGGACCCTCCATTGTC R: AGCCATGCCAATCTCGTCTT	120
ChREBP	NM_001110841	F: CTGACGTGGCTCTTCGAGTG 1 R: TCCAGATGGCATTGTTGAGG	127
SREBP-1c	XM_015294109	F: AGGCGGAGGTGATGGAGAT R: TCGGAGTCACTGCTGCTGTT	112
FAS	NM_205155	F: TTTGGTGGTTCGAGGTGGTA R: CAAAGGTTGTATTTCGGGAGC	215
ACC	J03541	F: GCTTCCCATTTGCCGTCCTA R: GCCATTCTCACCACCTGATTACTG	185
PPARα	AF163809	F: TTT AAC GGA GTT CCA ATC GC R: AAC CCT TAC AAC CTT CAC AAG C	224
MTTP	NM001109784	F: GCAGATGGACAGAGTTGGCT R: ACACCAAAAGTGCAAGGTGC	224
LPL	NM205282	F: CCGATCCCGAAGCTGAGATG R: ACATTCCTGTCACCGTCCAC	186
CPT1	AY675193	F: TAGAGGGCGTGGACCAATAA R: TGGGATGCGGGAGGTATT	229
PPARγ	NM001001460	F: CCAAGGCAGCGGCAAAATAA R: GTGCCCATAAATGATGGCCTAA	188
C/EBPα	NM001031459	F: GACATCTGCGAGAACGAGCA R: GCATGCCGTGGAAATCGAAA	154
C/EBPβ	NM_205253.2	F: GCCGCCCGCCTTTAAA R: CCAAACAGTCCGCCTCGTAA	188

^a β-actin, beta-actin; ChREBP, carbohydrate response element-binding protein; SREBP-1c, sterol regulatory element‐binding transcription factor-1c; FAS, fatty acid synthase; ACC, acetyl-coenzyme A carboxylase; PPAR, peroxisome proliferator–activated receptor; MTP, microsomal triglyceride transfer protein; LPL, lipoprotein lipase; CPT1, carnitine palmitoyl transferase 1; C/EBP, CCAAT/enhancer-binding protein.

Table 3. Effects of heat stress exposure on growth performance of broilers.

Items^a	Control	Heat stress	P-value
Initial body weight, g	740 ± 15.0	742 ± 10.2	0.769
Final body weight, g	2186 ± 46.1	1839 ± 29.5	<0.001
ADG, g	68. 9 ± 1.84	52.2 ± 1.61	<0.001
ADFI, g	146 ± 1.75	118.2 ± 1.94	<0.001
FCR	2.12 ± 0.06	2.26 ± 0.07	0.002

^aADG, average daily gain; ADFI, average daily feed intake; FCR, feed conversation ratio. 

Statistical analysis

The pen as the experimental unit, all data were analysed using the general linear model (GLM) procedure of the SAS 2003 (SAS Institute Inc., Cary, NC). The statistical differences between the CON and HS group were using Student’s t-test for unpaired data. The results presented as mean ± standard error, and P < 0.05 indicated significant difference.

Results

Rectal temperature

As shown in Figure 1, after 1-day, 7-day, 14-day and 21-day heat stress exposure, the rectal temperature in the HS group was higher (P < 0.05) than that in the CON group.

Figure 1. Effects of heat stress exposure on the rectal temperature of broilers. CON, control group; HS, heat stress exposure. The pound key (#) indicated significant difference (P < 0.05).

Growth performance

As shown in Table 3, heat stress exposure decreased (P < 0.05) the final body weight, ADG and ADFI when compared to the CON group, while increased (P < 0.05) the FCR.

Relative weight of abdominal adipose and liver

As shown in Figure 2, heat stress increased (P < 0.05) the relative weight of abdominal adipose and liver when compared to the CON group.

Figure 2. Effects of heat stress exposure on the relative weight of abdominal adipose and liver of broilers. CON, control group; HS, heat stress exposure. The pound key (#) indicated significant difference (P < 0.05).

Lipid metabolism parameters in serum and liver

As shown in Figure 3, heat stress increased (P < 0.05) the content of TC and TG in the serum, but had no significant effects on VLDL, LDL, or HDL content. In addition, heat stress increased (P < 0.05) the content of TC, TG, and VLDL in the liver, but had no significant effects on LDL or HDL content (Figure 4).

Figure 3. Effects of heat stress exposure on the lipid metabolism parameters in serum of broilers. CON, control group; HS, heat stress exposure; TC, total cholesterol; TG, triglyceride; VLDL, very low-density lipoprotein; LDL, low-density lipoprotein; HDL, high-density lipoprotein. The pound key (#) indicated significant difference (P < 0.05).

Figure 4. Effects of heat stress exposure on the lipid metabolism parameters in liver of broilers. CON, control group; HS, heat stress exposure; TC, total cholesterol; TG, triglyceride; VLDL, very low-density lipoprotein; LDL, low-density lipoprotein; HDL, high-density lipoprotein. The pound key (#) indicated significant difference (P < 0.05).

Gene expression related to lipid metabolism

In the liver, heat stress increased (P < 0.05) the mRNA expression level of FAS and ACC which were related to lipogenesis (Figure 5A), while the mRNA expression level of PPARα, MTTP, LPL, and CPT1 which were related to lipolysis were not significantly affected (Figure 5B).

Figure 5. Effects of heat stress exposure on gene expression related to lipid metabolism in the liver and abdominal adipose of broilers. CON, control group; HS, heat stress exposure; ChREBP, carbohydrate response element-binding protein; SREBP-1c, sterol regulatory element–binding transcription factor-1c; FAS, fatty acid synthase; ACC, acetyl-coenzyme A carboxylase; PPAR, peroxisome proliferator–activated receptor; MTTP, microsomal triglyceride transfer protein; LPL, lipoprotein lipase; CPT1, carnitine palmitoyl transferase 1; C/EBP, CCAAT/enhancer-bindingprotein. The pound key (#) indicated significant difference (P < 0.05).

In the abdominal adipose, heat stress only increased (P < 0.05) the mRNA expression level of ACC (Figure 5C), while the lipolysis related genes PPARα, LPL, and CPT1 were not significantly affected (Figure 5D). Moreover, we also detected the mRNA expression level of PPARγ, C/EBPα, and C/EBPβ in the abdominal adipose, which could affect preadipocytes differentiation. Heat stress increased (P < 0.05) the mRNA expression level of C/EBPα (Figure 5E).

Discussion

The rectal temperature was one of the indicators of heat stress, which reflected the body temperature. In broilers, the rectal temperature reflected the balance between heat gain and loss (Farag and Alagawany 2018). In this study, the rectal temperature of heat stress exposure broilers was higher on day 1, 7, 14, and 21, which suggested that physiological response and heat stress model established (Zhang et al. 2018; He et al. 2019).

Heat stress induced a series of deleterious impacts on physiology and immunology of poultry, including decreased feed intake and feed utilisation, disturbing intestinal and immune function, inducing endocrine disorder and oxidative damage (Farag and Alagawany 2018; Gonzalez-Rivas et al. 2020; Wasti et al. 2020; Kikusato et al. 2021), which resulted in poor productivity. As expected, heat stress exposure decreased ADG and ADFI, while increased FCR. These results were in consistent with the reports by Cheng et al. (2019), who reported that heat stress exposure decreased ADG and ADFI, as well as increased FCR. Heat stress exposure decreased ADG may related to the lower feed intake and feed utilisation (Habashy et al. 2017a, 2017b; Chang et al. 2020). Moreover, to adapt the high temperature, heat-stressed broilers might consume more energy to maintain homeostasis, thereby reducing energy supply for growth and resulting in poor growth performance (Nawab et al. 2018).

Previous studies indicated that heat stress exposure increased liver fat synthesis and abdominal adipose deposition in broilers (Lu et al. 2007; Flees et al. 2017; Lu et al. 2019; Yin et al. 2021). In this study, heat exposure increased the relative weight of liver and abdominal adipose. Abdominal adipose deposition mainly depended on the hepatic DL and plasma TG absorption (Hermier 1997). TG was synthesised in the liver and VLDL played a vital role in exportation TG to extra-hepatic tissue, which suggested that abdominal adipose deposition was related to the levels of TG and VLDL in plasma (Cryer 1981; Griffin et al. 1991). In this study, heat exposure increased serum TC and TG, suggested that heat stress exposure increased abdominal adipose deposition might be due to the increased TG exportation from the liver, as well as enhanced fatty acid uptake in abdominal adipose. These results were consistent with the results of He et al. (2015) and Lu et al. (2019). Moreover, abdominal adipose development included the preadipocytes hyperplasia (enhanced in number) and hypertrophy (enhanced in volume) (Guo et al. 2011). PPARγ, C/EBPα, and C/EBPβ were reported as the key regulators in preadipocytes differentiation, and played vital role in affecting abdominal adipose deposition (Farmer 2006; Xu et al. 2021). Higher C/EBPα mRNA expression level in the HS group suggested that abdominal adipose deposition was promoted in some degree. ACC mRNA expression was up-regulated in abdominal adipose by heat stress exposure among all detected genes (ChREBP, SREBP-1c, FAS, and ACC) associated with lipogenesis, while the genes (PPARα, LPL, and CPT1) associated with lipolysis was not significant affected. Broilers DL mainly occurred in the liver, but less in abdominal adipose (O'hea and Leveille 1968), thus we speculated that heat stress exposure promoted adipocytes proliferation might comprehensively demonstrated the possible reason for increasing abdominal adipose deposition.

Hepatic TG accumulation was the balance among plasma non-esterified fatty acid absorption, DL, fatty acid oxidation and the secretion of VLDL-TG (Hodson and Gunn 2019). Fatty acid synthesised in the liver was incorporated into TG and packed into VLDL, which ferry to hepatic-extra tissues for storage or energy supply (Emami et al. 2020). In this study, heat stress exposure enhanced liver TC, TG, and VLDL level, indicating enhanced fat synthesis and TG exportation, which was in line with higher serum TC and TG level. Liver VLDL assembly and subsequent secretion from hepatocytes was depended on MTTP (Liu et al. 2016, 2019). In this study, the MTTP mRNA expression was not influenced by heat stress exposure, suggesting that heat stress exposure may limit TG export from liver. Thus, the threshold of MTTP might be the main factor for lipid accumulation in the liver of broilers exposed to heat stress, the results consistent with the higher weight of liver in broilers.

Conclusions

In conclusion, heat stress (34 °C) exposure increased abdominal adipose deposition, serum TC and TG level, the mRNA expression of FAS and ACC, promoted preadipocytes differentiation by increasing C/EBPα mRNA expression in abdominal adipose of broilers. Therefore, heat stress exposure increased abdominal adipose deposition, which related to the increasing in hepatic DL, and promoted preadipocytes differentiation in abdominal adipose.

Ethical approval

The experimental protocol used in this study was approved by the Animal Care and Use Committee of Guangdong Ocean University (SYXK-2018-0147).

Disclosure statement

No conflict of interest was reported by the authors.

Data availability statement

The original data of the paper are available upon request from the corresponding author.

Additional information

Funding

This work was supported by the program for scientific research start-up funds of Guangdong Ocean University (101402/R18005).