Effects of spirulina platensis addition on performance, immune response, hematological, selected bacteria activity and rumen morphology of lambs

Abstract

The aim of this study is to investigate the effects of different levels of Spirulina platensis in the diet on performance, immune response, hematological, activity of selected bacteria and rumen morphology of lambs. Forty-eight weaned lambs (aged 3 months) were used and then divided into four groups with 6 pens per group (2 lambs/pen), including a control group and three groups fed pelleted complete feed containing 0.20%, 0.40% and 0.80% spirulina powder, respectively. The study lasted 70 days, during which all target parameters were assessed and analysed. The results showed that spirulina powder had a positive effect on body weight and daily weight gain of lambs on days 42–70 and 1–70 (p < 0.05). Daily feed intake was also increased by spirulina powder (p < 0.05). The T2 and T3 had a higher white blood cell count (35 and 70 days) (p < 0.05). The percentage of granulocytes increased at T3 (35 days) and T2 (70 days), while lymphocytes at T3 (35 and 70 days) and monocytes at T1 and T2 (35 days) were decreased (p < 0.05). Red blood cell counts and percent haematocrit were lower at T1 (35 days), T1 and T3 (70 days) (p < 0.05). IL-2 in T3 (35 and 70 days), IL-4 in T1 (35 days) and IL-10 in the spirulina groups (70 days) were higher (p < 0.05). Butyrivibrio fibrisolvens was higher in the T2 and T3 groups and lower in the T1 group (p < 0.05). In addition, Ruminocoocus Albus, Ruminococcus Flavefaciens and Streptococcus Bovis were higher in the Spirulina groups (p < 0.05). Papilla height (T2), papilla area, density and total papilla area (T2 and T3) were increased (p < 0.05). In conclusion, the results suggest that lambs fed Spirulina platensis had higher weight gain and feed intake, white blood cell count and IL-2, IL-4, and IL-10 levels, rumen microbiota, papilla height, density, and total papilla surface area compared to the control group, with most parameters tending to be higher in dose. Nevertheless, further studies are needed to elucidate the specific mechanisms and to determine the most effective and safest dose of Spirulina platensis for lambs.

HIGHLIGHTS

• Spirulina platensis increased gain weight, white blood cells and specific immune factors.

• Certain beneficial bacteria in the rumen were higher with Spirulina.

• Rumen papillae, important for nutrient absorption, increased with Spirulina.

• These findings suggest Spirulina could be a helpful feed additive for lambs.

Keywords:

• Lambs
• performance
• immunity
• bacteria
• rumen morphology

Introduction

Livestock production faces a challenging future globally, and particularly in Saudi Arabia, as the demand for edible protein sources for humans increases (Alhidary et al. 2016a, 2016b). Lamb can play a role in meeting this demand and contribute to social and economic sustainability in the region. The identification of new feed resources and additives is essential for sustainable animal production and the maintenance of animal health and welfare (Pereira et al. 2013). However, the use of natural and healthy feed additives has positive effects on nutritional value, animal health and performance (Khalifa et al. 2016). Khalifa et al. (2014) confirmed that feed additives can play an important role in improving the performance and health of ruminants.

Spirulina platensis is a microscopic blue-green alga and an organic source rich in proteins, vitamins and minerals, which makes it a good dietary supplement for various animals, including lambs (Lupatini et al. 2017; Costa et al. 2019; Koyande et al. 2019). It is used as a non-traditional food source because it is considered safe as it has been approved by the U.S. Food and Drug Administration (Navacchi et al. 2012). However, the production of microalgae has recently received special attention because these microorganisms can be a good alternative source of protein for the diet (Rogatto et al. 2004). Several studies have been conducted on the use of Spirulina platensis powder as a dietary supplement in different animals such as pigs (2 and 3 g Spirulina/head/day), goats (2 to 4 g Spirulina/head/day) and lambs (1 g Spirulina/10 kg body weight/day), in which an increase in live weight was observed compared to the basal diet (Šimkus et al. 2013; EL-Sabagh et al. 2014; Holman et al. 2014; Nedeva et al. 2014; Furbeyre et al. 2017; Al-Yahyaey et al. 2022). Other studies mainly focus on the fact that the addition of Spirulina platensis to the diet has a protective effect on the liver and improves the antioxidant status and immune response of calves at 6 g Spirulina per day (Ghattas et al. 2019) and lambs at 3% Spirulina during the study period (Liang et al. 2020). The mechanisms of action of Spirulina platensis on lamb performance and health are not yet fully understood, but may be related to the highly digestible protein content, which could improve nutrient utilisation and growth at 1 g/10 kg body weight/day of Spirulina platensis powder (Hanafy, 2023). Research suggests that Spirulina platensis contains various bioactive compounds such as phycocyanin, tocopherols and phenols, which may have antioxidant and immunomodulatory properties (Gargouri et al. 2019; Anvar and Nowruzi, 2021). However, several studies have shown that the addition of Spirulina platensis to the diet of ruminants (lambs and goats) has positive effects on growth performance, regulation of immune response and bacterial activity (Madeira et al. 2017).

To our knowledge, previous studies on the efficacy of feeding Spirulina platensis to growing lambs are very limited and the effects on the immune response, hematological and bacterial activity and rumen morphology of growing lambs are not clearly understood. In the current study, it was hypothesised that the addition of Spirulina platensis could have positive effects on animal health by altering the microbial environment in the rumen and improving the immune response due to the nutrients and active ingredients it contains, which could translate into improved lamb performance and health. Therefore, the main objective of this study is to evaluate the effects of different levels of Spirulina platensis in the diet of growing lambs on the performance, immune response, hematological activity of selected bacteria and rumen morphology of growing lambs.

Materials and methods

Ethical approval

The conduct of the present study, including feed addition, animals, sample collection and analyzes used, was approved by the Standing Committee for Scientific Research Ethics of King Saud University, Riyadh, Kingdom of Saudi Arabia (Ethics Reference KSU-SE-21–04).

Study design and management

A total of 48 post-weaned growing lambs (Najdi breed) aged three months purchased from a reliable company (Al-Khalidiya Sheep Company, Riyadh, Saudi Arabia) were used for the present study. After the arrival of the lambs, they were acclimatised to the basal diet for 15 days at the study site. During this period, they were constantly examined and vaccinated against common diseases (enterotoxemia, septicaemia and peste des petits ruminants) according to the recommendations of the Department of Livestock of the Ministry of Environment and Water, Agriculture in the Kingdom of Saudi Arabia (manufactured by Ibriz Company - Kingdom of Saudi Arabia). The basal diet was formulated as a pelleted complete feed and met the nutritional requirements of the recommendations of the Management Guide for Growing Lambs (NRC 2007) for 70 days. Spirulina platensis powder (Arthrospira platensis) was purchased from from a commercial supplier (TAAU, Darwin, Northern Territory, Australia). All growing Najdi lambs were randomly assigned to four feeding treatments with 6 pens (2 m x 3 m) as experimental units using a completely randomised design with 2 lambs per pen (12 lambs per treatment). The treatment groups were divided as follows: CON = control group, lambs fed pelleted complete diet without any additive as basal diet, and T1 to T3 = lambs fed pelleted complete diet with feed additives of 0.20, 0.40 and 0.80% spirulina powder (dry matter basis), respectively. Table 1 shows the composition of the diet and the nutrient analysis covering the lambs’ requirements on a dry matter basis for each treatment. All lambs were fed ad libitum throughout the study.

Table 1. Ingredients and nutrient analysis‎ of complete pelleted diet fed growing lambs.

Ingredients ‎	%
Corn	30.00
Wheat, grain	29.00
Alfalfa hay	35.00
Salt	1.00
Limestone	2.25
Molasses	2.00
Mineral and vitamin premix*	0.75
Total	100.00
Nutrients analysis
Crude protein	14.47
Acid detergent fibre	26.91
Neutral detergent fibre	40.72
Lignin	5.61
Non-fibrous carbohydrates	28.63
Fat	1.77
Ash	14.42
Calcium	1.18
Phosphorus	0.27
Magnesium	0.27
Potassium	1.87
Sulfur	0.23
Sodium	0.97
Zinc, ppm	25.00
Copper, ppm	5.50
Total Digestible Nutrients	71.90
Net energy, kcal/kg	1642.45

* Contained per kg, 10,000 IU vitamin A, 1000 IU vitamin D, 20 IU vitamin E, 300 mg Mg, 24 mg Cu, 0.6 mg Co, 1.2 mg I, 60 mg Mn, 0.3 mg Se, 60 mg Zn‎‎.

Chemical and major bioactive composition of spirulina powder

The analysis of spirulina powder and diet were performed to determine the content of nutrients including dry matter (at 105 °C for 24 h by drying oven), crude protein (Kjeldahl method, N content multiply by 6.25 to determined crude protein), ash, total fat, neutral and acidic fibre according to the methods of the Association of Official Analytical Chemists (AOAC, 2012). Minerals including calcium, phosphorus, magnesium and potassium were analysed using atomic absorption spectrometer (PerkinElmer, MA, USA). Net energy was determined by calculating net energy from digestible energy, with accounts for metabolic losses, to determine utilisable energy in vitro. The techniques are based on simulating the digestion of animals using enzymes and solvents to estimate the digestibility of nutrients according to the method described previously (Sallam et al. 2007). To identify the main bioactive compounds, spirulina was extracted with a methanol solution and then analysed by ultra-high-performance liquid chromatography-mass spectrometry (Agilent Technologies, Palo Alto, CA, USA) according to the method described by Sabaragamuwa et al. (2022). The result of bioactive composition was expressed as a percentage of spirulina extract.

Growth performance indicators

The study involved the measurement of body weight and feed intake weekly using a digital scale after a 10-hour feed deprivation period for each growing lamb during the study period from 1 to 70 days. This assessment was carried out weekly using a digital scale. The purpose of this assessment was to determine the daily weight gain, which was calculated as the difference between the final weight and the initial weight divided by the number of days. In addition, feed conversion ratio was calculated by dividing the daily feed intake by the daily weight gain. These calculations were performed according to the equations described by Hanafy (2023). This approach allowed a comprehensive assessment of the lambs’ growth performance and feed efficiency of the lambs throughout the study period.

Sampling and analysis of blood indices

Whole blood (10 mL) was collected from the jugular vein of all lambs after 10 h of feed deprivation (12 lambs per treatment group) at initial, middle and end of the study (1, 35 and 70 days) in tubes containing ethylenediaminetetraacetic acid (BD Company, Franklin Lakes, NJ) as an anticoagulant (Saghir et al. 2023). Haematologic parameters within 3 h of blood collection, including total white blood cells, lymphocytes, monocytes, granulocytes, red blood cells, haemoglobin, and haematocrit, were measured using an automated haematology analyser (Cell-Dyn 3700; Abbott, Abbott Park, Illinois) according to the manufacturer’s instructions. Plasma was separated by centrifugation at 3500 x g for 15 min and frozen at −20 °C until analysis of the immune response indicators. The concentrations of- interleukins (IL-1, IL-2, IL-4, IL-6, IL-10, and IL-12), tumour necrosis factor-alfa (TNF-α), and interferon-gamma (IFN-γ) were measured using enzyme-linked immunosorbent assay kits (Bioassay Technology Laboratory, Zhejiang, China) and a microplate reader (MR-96A; Mindray Bio-Medical Electronics Co, Ltd, Shenzhen, China), as previously described by Abdelnour et al. (2020).

DNA preparation and quantification of rumen bacteria

At the end of the study (70 days), rumen fluid samples were taken from each lamb at slaughter after 10 h of feed deprivation and stored at −80 °C until DNA extraction. The samples (3 mL/lamb) were centrifuged (10,000 × g, 15 min, 4 °C), and the solid part was stored after removal of the supernatant. Total DNA was extracted for each sample using the extraction kit (Qiagen, Germantown, MD) with silica beads (0.1 mm diameter) for homogenisation according to the manufacturer’s protocol. The extracted DNA was evaluated using Nanodrop spectrophotometer (Thermo Scientific, 2000 Nanodrop, Waltham, MA, USA) by absorbance at 260 nm and 280 nm to determine the purity and concentration. Extracted DNA was stored at −80 °C for real- time quantitative polymerase chain reaction (qPCR) analysis. Quantitative PCR was performed using the Power SYBR^® Green PCR Master Mix (Qiagen, Valencia, CA, USA) on a real-time PCR system (7300 Real-Time PCR System, Applied Biosystems), with target primers, designed for specific bacteria (Anaerovibrio Lipolytica, Butyrivibrio Fibrisolvens, Fibrobacter Succinogenes, Ruminocoocus Albus, Ruminococcus Flavefaciens, Selenomonas Ruminantium and Megashpaera Elsdenii), as indicated in Table 2. A melting curve was constructed to determine the amplification of the individual products and to quantify the qPCR results of the selected bacteria. The results were expressed as absolute quantities (Log₁₀ microbial per 1 mL of rumen fluid) based on a standard curve amplified for serially diluted pool DNA bacteria, as in previous studies (Zapata et al. 2021).

Table 2. Primer sequences used in this study to quantitative PCR analysis.

Target gene	Forward and Reverse primer (5′ → 3′)	Product length	GenBank ‎ ‎number
Anaerovibrio Lipolytica	F: CACCAAGGCGACGATCAGTA R: CTGCCTCCCGTAGGAGTTTG	86	AB034191.1
Butyrivibrio Fibrisolvens	F: AGTAACGCGTGGGTAACCTG R: AAATCATGCGATTCCGTGCG	89	U41167.1
Fibrobacter Succinogenes	F: GTGCAAGCGTTGTTCGGAAT R: TCTACGCATTCCACCGCTAC	163	AB275514.1
Ruminocoocus Albus	F: AAAGAAGAAAGGCGGAGCGA R: CAGGCTTCGGCTCGATATGT	143	CP002407.1
Ruminococcus Flavefaciens	F: CGTTACCGCCCTTTCCTGAT R: AGGACGGCAAGCAATGAGAA	74	NC_001758.1
Selenomonas Ruminantium	F: GGTCTGAGAGGATGAACGGC R: CGAGCCGAAACCCTTCTTCA	137	M62703.1
Megashpaera Elsdenii	F: GCCGGTCTGAGAGGATGAAC R: AGACTTTCGTCCATTGCGGA	99	NR_113306.1
Total bacteria	F: GTGSTGCAYGGYTGTCGTCA R: ACGTCRTCCMCACCTTCCTC	130	NR_2828033

Design and test primers for this sequence using NCBI primer-BLAST‎. ‎.

Rumen morphology

Tissue samples (2 cm) were taken from the ventral rumen sac of each lamb and processed for analysis. Tissues were fixed in 10% neutral buffer for 72 h, dehydrated (50 to 100% ethanol) and cleared with xylene for 60 min each using an automated tissue processor (Tissue-Tek VIP 5 Jr, Sakura, Japan). Subsequently, the samples were then cut into thin sections (5 µm) using an automatic microtome system (Leica Bio-systems, Germany) and stained with hematoxylin-eosin on microscope slides. The height, width and density of the rumen papillae were measured using a light microscope (Nikon, Corp, Japan) and an image analyser (AmScope digital camera connected to the Ceti England microscope). These measurements were used to calculate the papilla surface area and total surface area (Cui et al. 2019).

Statistical data analysis

To verify normality and homogeneity of variances, the Shapiro-Wilk and Levene tests were applied to all data obtained for the present study. All the results were analysed using a one-way ANOVA with general linear models implemented in SAS 9.4 software (SAS, 2008).

The statistical model was created according formula [Observed values (Yij) = general mean (μ) + treatment groups (i = CON, T1, T2, and T3) + experimental error (eij)].

Tukey’s test (p < 0.05) was used to detect statistically significant differences between means. The mean values of each parameter were expressed as mean ± standard error of the mean.

Results

Chemical composition and major bioactive compounds analysis

The chemical composition and major bioactive compounds of spirulina platensis are listed in Table 3. The results of chemical analysis showed that spirulina platensis was rich in crude protein (58.18%), ash (12.57%) and starch (47.60%). In addition, the major bioactive compounds such as caffeine, amphetamine, 4-aminophthalimide, 5,8-indolezidine, and 9-octadecinamide (60.41, 23.99, 2.70, 1.89 and 1.15%, respectively) were more abundant in Spirulina platensis extract when detected by ultra-high-performance liquid chromatography-mass spectrometry.

Table 3. Chemical composition of spirulina platensis as dry mater and major bioactive compounds of their extract.

Nutrients analysis	%
Dry matter	93.86
Crude protein	58.18
Neutral detergent fibre	6.92
Acid detergent fibre	2.54
Ash	12.57
Total fat	1.44
Starch	17.60
Calcium	0.14
Phosphorus	0.47
Magnesium	0.19
Potassium	0.90
Net energy, kcal/kg	1960.65
Major bioactive compounds	%
Amphetamine (C9H13N)	23.99
Caffeine (C8H10N4O2)	60.41
4-Aminophthalimide (C18H23N)	2.70
5,8-Indolizidine (C15H23N)	1.89
9-Octadecenamide (C18H35NO)	1.15

Nutrient analysis of dietary treatments was performed in duplicate.

The bioactive compounds were analysed using ultra-high-performance liquid chromatography-mass spectrometry in duplicate.

Production performance indicators

The effects of feed supplements containing spirulina platensis on the production performance of lambs are shown in Table 4. The results show that there were no differences (p > 0.05) in body weight within the treatment groups at 1, 14 and 28 days. On the other hand, body weight was affected (p < 0.05) by the treatment groups in the other study periods (42 – 70 days), with lambs receiving T1 to T3 had higher body weight than the CON group. Daily weight gain was unaffected in all treatment groups during the periods 1 – 14 days, 14 – 28 days, 28 – 42 days and 56 – 70 days (p > 0.05). In the periods 42 – 56 days and 1 – 70 days, the lambs fed with T1 to T3 had a higher daily weight gain (p < 0.05). Daily feed intake was increased in the treatment groups (p < 0.05), during the periods 1 – 70 days, with the exception of 14 – 28 days, while feed conversion ratio was not influenced by the treatment groups (p > 0.05).

Table 4. Effect of feed additives with spirulina platensis on productive performance in lambs.

Parameters	Treatment groups^a				SEM^b	p-value
	CON	T1‎	T2‎	T3‎
Body weight (kg)
1 day	21.99	21.95	21.99	22.05	0.56	0.990
14 days	26.05	26.94	27.20	27.11	0.64	0.589
28 days	30.09	30.56	31.56	31.36	0.63	0.355
42 days	33.71^b	34.86^a	36.36^a	36.34^a	0.66	0.020
56 days	37.48^c	39.86^b	42.71^a	42.06^a	0.66	<0.0001
70 days	41.05^b	44.91^a	46.14^a	45.83^a	0.84	0.008
Daily weight gain (g)
1–14 days	290	356	372	362	24.9	0.115
14–28 days	288	259	311	304	16.6	0.162
28–42 days	259	286	343	355	29.8	0.098
42–56 days	269^b	379^a	454^a	409^a	32.1	0.003
56–70 days	255	361	245	269	33.8	0.089
1–70 days	272^b	328^a	345^a	340^a	13.6	0.003
Daily feed intake (kg)
1–14 days	1.12^b	1.17^b	1.23^a	1.27^a	0.01	<0.0001
14–28 days	1.48	1.39	1.62	1.54	0.05	0.069
28–42 days	1.54^b	1.89^a	1.82^a	2.04^a	0.10	0.004
42–56 days	1.54^b	2.11^a	2.13^a	2.16^a	0.07	<0.0001
56–70 days	1.45^b	2.03^a	1.77^a	1.89^a	0.12	0.011
1–70 days	1.43^b	1.72^a	1.70^a-	1.78^a	0.05	0.001
Feed conversion ratio (g:g)
1–14 days	4.23	3.40	3.31	3.61	0.29	0.156
14–28 days	5.27	5.57	5.31	5.22	0.41	0.929
28–42 days	6.35	6.76	5.85	5.84	0.45	0.446
42–56 days	6.31	5.81	4.80	5.45	0.47	0.198
56–70 days	6.15	6.03	7.19	7.30	0.51	0.198
1–70 days	5.35	5.26	4.96	5.28	0.19	0.562

^{a -b} Means values within rows for each item with clarification of the significant difference in the ‎form ‎of superscripts (p < ‎‎0.05). ‎

^aTreatment groups: lambs fed complete pellet diets without any addition as basal diet (CON; control group) and T1 to T3= lambs fed complete pellet diets with feed additives by 0.20, 0.40, and 0.80 % of spirulina powder, respectively.

^bSEM = standard error of means for diets effect.‎

Hematological parameters

The effects of feed supplements containing spirulina platensis on the hematological parameters of lambs are shown in Table 5. At 35 days, lambs receiving T3 and T2 followed by T1 had higher white blood cell counts than the CON group (p < 0.05). The percentage of granulocytes increased and that of lymphocytes decreased in the T3-fed lambs compared to the T1 and CON groups (p < 0.05), but this did not change at T2. In addition, the percentage of monocytes was lower in the T3- fed lambs compared to the other treatment groups (p < 0.05). Red blood cell counts and percent haematocrit were lower in lambs fed T1 compared to the other treatment groups (p < 0.05). The haemoglobin concentration was higher in T3 than in the T1 and CON groups (p < 0.05), but not in T2.

Table 5. Effect of feed additives with spirulina platensis on hematological parameters in lambs‎.

Parameters	Treatment groups^a				SEM^b	p-value
	CON	T1‎	T2‎	T3‎
At 35 days
White blood cell (10^g/L)	7.15^c	9.73^b	13.16^a	12.42^a	0.38	<0.0001
Lymphocytes %	56.26^a	59.45^a	50.12^a^b	41.34^b	2.91	0.002
Monocytes %	4.06^b	5.59^a	5.38^a	2.63^c	0.61	0.013
Granulocytes %	39.69^b	34.97^b	44.50^a^b	56.03^a	3.43	0.003
Red blood cell (10^12/L)	12.32^a	8.81^b	12.90^a	13.35^a	1.11	0.044
Haemoglobin (g/dL)	8.87^c	9.58^b	9.99^a^b	10.39^a	0.16	<0.0001
Haematocrit %	27.21^a	21.77^b	29.86^a	30.83^a	1.73	0.008
At 70 days
White blood cell (10^g/L)	8.50^b	10.20^a^b	11.28^a	11.93^a	0.75	0.018
Lymphocytes %	56.09^a	51.31^a^b	42.20^b	48.47^a^b	3.14	0.031
Monocytes %	3.09	4.09	3.06	3.91	0.58	0.472
Granulocytes %	40.81^b	44.65^a^b	54.78^a	47.64^a^b	3.07	0.023
Red blood cell (10^12/L)	12.72^b	14.08^a	13.45^a^b	14.09^a	0.28	0.005
Haemoglobin (g/dL)	9.73^b	10.59^a^b	10.47^a^b	10.78^a	0.25	0.034
Haematocrit %	28.83^b	31.26^a^b	31.16^a^b	32.08^a	0.63	0.008

^{a –b}Means values within rows for each item with clarification of the significant difference in the ‎form ‎of superscripts (p < ‎‎0.05).

^a Treatment groups: lambs fed complete pellet diets without any addition as basal diet (CON; control group) and T1 to T3= lambs fed complete pellet diets with feed additives by 0.20, 0.40, and 0.80 % of spirulina powder, respectively.

^b SEM: standard error of means for diets effect.‎

At the end of the study (70 days), the lambs receiving T2 and T3 had a higher white blood cell count than the CON group (p < 0.05), but this was not the case in T1. The percentage of granulocytes increased and the percentage of lymphocytes decreased in the T2-fed lambs compared to the CON groups (p < 0.05), but not affected by T1 and T3. In contrast, monocytes percentage was not affected in the treatment groups (p > 0.05). Red blood cell counts were lower in T1- and T3-fed lambs than in the CON group (p < 0.05), but were not affected by T2. Haemoglobin concentration and haematocrit were higher in the T3 group than in the CON group (p < 0.05), but not in the T1 and T2 groups.

Immune response indicators

The effects of feed supplements containing spirulina platensis on the immune response indicators of lambs are shown in Table 6. The current results show that cytokine levels in the blood of lambs, including IL-1, IL-6, IL-12, TNF-α and IFN-γ, were not affected by the treatment groups at 35 and 70 days (p > 0.05). In contrast, lambs receiving T3 followed by T2 and T1 had higher IL-2 levels than the CON group at 35 and 70 days (p < 0.05). At 35 days, IL-4 levels were higher in the T1 group than in the CON group, but unaffected by T2 and T3, while at 70 days they were unaffected by the treatment groups. In addition, IL-10 levels were affected in the treatment groups (T1-T3) at 70 days (p < 0.05), while it was not affected at 35 days compared to the CON group (p > 0.05).

Table 6. Effect of feed additives with spirulina platensis on immune response indicators in lambs.

Parameters^a	Treatment groups^b				SEM^c	p-value
	CON	T1‎	T2‎	T3‎
At 35 days
IL-1 pg/mL	49.5	53.3	60.3	54.8	3.37	0.212
IL-2 pg/mL	386.6^c	536.3^b	667.3^a	731.4^a	29.3	<0.0001
IL-4 pg/mL	63.6^b	83.8^a	72.0^a^b	74.2^a^b	3.99	0.027
IL-6 pg/mL	182.0	165.1	146.4	149.1	11.0	0.139
IL-10 pg/mL	161.1	140.3	145.1	137.7	9.50	0.345
IL-12 pg/mL	504.4	576.2	540.0	586.2	42.9	0.542
TNF-α pg/mL	62.9	72.4	74.7	73.1	4.31	0.254
IFN-γ pg/mL	38.2	31.5	34.5	33.1	3.03	0.471
At 70 days
IL-1 pg/mL	53.3	61.8	65.3	51.86	4.33	0.120
IL-2 pg/mL	422.8^c	539.6^b	590.8^b	719.17^a	22.2	<0.0001
IL-4 pg/mL	70.7	76.0	70.4	74.11	4.91	0.823
IL-6 pg/mL	142.3	149.5	162.6	156.26	7.96	0.340
IL-10 pg/mL	129.7^b	148.5^a	153.8^a	157.03^a	7.58	0.048
IL-12 pg/mL	535.5	582.9	614.5	597.64	30.2	0.321
TNF-α pg/mL	65.9	68.9	66.8	86.01	5.42	0.058
IFN-γ pg/mL	31.3	32.6	37.4	35.62	3.64	0.633

^{a -c}Means values within rows for each item with clarification of the significant difference in the ‎form ‎of superscripts (p < ‎‎0.05).

^a IL = interleukin, TNF-α= tumour necrosis factor- α and IFN-γ= Interferon gamma.

^b Treatment groups: lambs fed complete pellet diets without any addition as basal diet (CON; control group) and T1 to T3= lambs fed complete pellet diets with feed additives by 0.20, 0.40, and 0.80 % of spirulina powder, respectively.

^c SEM: standard error of means for diets effect‎.

Selected rumen microbiota activity

The effects of feed supplements containing spirulina platensis on selected rumen bacteria activity of lambs are shown in Table 7. The absolute quantitively of Butyrivibrio Fibrisolvens had higher in lambs fed T3 and T2 groups and lower in lambs fed T1 group compared to CON groups (p < 0.05). In addition, Ruminocoocus Albus, Ruminococcus Flavefaciens and Streptococcus Bovis were higher quantitively in lambs fed treatment groups (T1-T3) than the CON group (p < 0.05). In contrast, other rumen bacteria including Anaerovibrio Lipolytica, Fibrobacter Succinogenes, Selenomonas Ruminantium and total bacteria were not influenced by the treatment groups (p > 0.05).

Table 7. Effect of feed additives with spirulina platensis on selected rumen bacteria activity (Log₁₀ microbial/ml) in lambs‎.

Parameters	Treatment groups^a				SEM ^b	p-value
	CON	T1‎	T2‎	T3‎
Anaerovibrio Lipolytica	4.21	3.49	4.62	4.17	0.27	0.082
Butyrivibrio Fibrisolvens	4.11^b	3.44^c	4.64^a	4.41^a	0.11	<0.0001
Fibrobacter Succinogenes	3.68	4.10	4.25	4.35	0.34	0.550
Ruminocoocus Albus	3.73^b	4.97^a	4.69^a	5.68^a	0.27	0.002
Ruminococcus Flavefaciens	5.24^b	6.61^a	6.51^a	7.34^a	0.22	0.002
Selenomonas Ruminantium	5.83	6.13	6.57	6.49	0.23	0.132
Streptococcus Bovis	4.85^b	5.35^a	5.43^a	5.95^a	0.22	0.032
Total bacteria	6.93	7.36	6.87	7.11	0.16	0.208

^{a -c}Means values within rows for each item with clarification of the significant difference in the ‎form ‎of superscripts (p < ‎‎0.05).

¹ Treatment groups: lambs fed complete pellet diets without any addition as basal diet (CON; control group) and T1 to T3= lambs fed complete pellet diets with feed additives by 0.20, 0.40, and 0.80 % of spirulina powder, respectively.

² SEM = Standard error of means for diets effect.‎

Morphology of the rumen tissue

The effects of feed supplements containing spirulina platensis on the morphology of the rumen tissue of lambs are shown in Table 8. The current results show that papilla height was higher in lambs receiving T2, followed by T1 and T3, than in the CON group (p < 0.05). Whereas, Papilla width was unaffected by the treatment groups (p > 0.05). The papilla surface area had higher in lambs fed T2 and T3 than in the other treatment groups (p < 0.05). In addition, the density and total surface area of the papillae were increased in lambs fed T2 and T3 followed by T1 compared to the CON group (p < 0.05).

Table 8. Effect of feed additives with spirulina platensis on rumen tissue morphology in lambs‎.

Parameters	Treatment groups^a				SEM^b	p-value
	CON	T1‎	T2‎	T3‎
Papilla height (mm)	0.93^c	1.10^b	1.26^a	1.18^b	0.03	<0.0001
Papilla width (mm)	0.19	0.19	0.20	0.21	0.01	0.196
Papilla surface area (mm)^2	0.56^b	0.67^b	0.79^a	0.79^a	0.03	<0.0001
Density (n/cm^2)	38.05^c	41.05^b	45.91^a	45.09^a	2.09	0.031
Total surface of papillae (mm^2/cm^2)	13.57^c	17.23^b	22.77^a	22.92^a	1.22	<0.0001

^{a –c}Means values within rows for each item with clarification of the significant difference in the ‎form ‎of superscripts (p < ‎‎0.05).

^aTreatment groups: lambs fed complete pellet diets without any addition as basal diet (CON; control group) and T1 to T3= lambs fed complete pellet diets with feed additives by 0.20, 0.40, and 0.80 % of spirulina powder, respectively. ‎

^bSEM: standard error of means for diets effect.‎

Discussion

Production performance indicators

Study suggest that supplementing lambs’ diets at 1 g/10 kg body weight/day of Spirulina platensis powder could be a strategic way to improve their growth performance (Hanafy, 2023). This is probably because spirulina is rich in essential nutrients such as vitamins, minerals, essential fatty acids and amino acids (Gershwin and Belay, 2008), which may promote faster growth in lambs. Research by Holman et al. (2014) even suggests that spirulina supplemented by oral daily in a water suspension at the ratio of 1:10 w/v can improve both performance and cost efficiency for lamb producers. In the current study, body weight was improved from day 42 to the end of the study by adding spirulina platensis to the lamb diet. In the periods 42 – 56 days and 1 – 70 days, the addition of spirulina platensis resulted in a higher daily weight gain. In contrast, daily feed intake was increased by the addition of spirulina platensis to the lamb diet, so that feed conversion ratio was not affected. These results are consistent with previous report that spirulina platensis at the rate of 10 and 20% wt/vol induced higher body weight, daily weight gain and feed intake in sheep (Holman et al. 2012). The improvement in growth performance in lambs fed spirulina platensis at a rate of 1 g/10 kg body weight/day may be attributed to stimulates the secretion of extracellular enzymes by the intestinal microflora (EL-Sabagh et al. 2014). In addition, the observed increase in body weight and average daily weight gain could be related to the increased production of crude microbial protein by spirulina platensis at 0.5 to 6.1 g/kg weight/day in the rumen of cattle (Panjaitan et al. 2015). In our study, feed intake was increased by the inclusion of spirulina platensis in the diet, which could promote optimal growth of the lambs. This is consistent with Lamminen et al. (2019) in cow, while not consistent with another study by Al-Yahyaey et al. (2022) in goat, who reported that the use of spirulina platensis increased growth performance and feed intake. Colla et al. (2007) reported that the addition of spirulina platensis to feed increased palatability and thus improved feed efficiency.

Hematological parameters

Leukocytes play an important role in non-specific or innate immunity and their count can be considered an indicator of relatively lower susceptibility to disease (Matanović et al. 2007). The results of this study show that lambs fed T2 and T3 had higher white blood cells counts at both 35 and 70 days. This suggests a possible stimulation of the immune system by spirulina supplementation, especially at higher doses. Studies have shown that a polysaccharide extract of Spirulina platensis (30 and 60 mg/kg) can increase white blood cells production in an irradiated haematopoietic system in mice and dogs, which is responsible for the formation of blood cells (Zhang et al. 2001). Research by Mariey et al. (2014) further supports these findings. In their study, a significant increase in the number of white blood cells and increased activity of macrophages (a type of phagocytic cell) was observed in animals treated with Spirulina platensis algae. These combined results suggest that Spirulina platensis has the potential to strengthen the immune system. Lambs fed 0.80% spirulina powder (T3) had a higher percentage of granulocytes (associated with fighting acute infections) and a lower percentage of lymphocytes (involved in adaptive immunity) at 35 days. This temporary shift in white blood cell types at the highest dose could indicate a short-term response to potential gut or immune challenges (Nielsen et al. 2010). The percentage of monocytes (involved in inflammation and tissue repair) remained unchanged by spirulina powder compared to the CON group. Interestingly, only T2 showed a similar increase in granulocytes and a decrease in lymphocytes at 70 days. This indicates a possible time-dependent effect of spirulina on the distribution of white blood cells. Red blood cell counts were lower in T1 and T3 fed lambs at both time points, while T2 remained unaffected. The haemoglobin concentration and white blood cell count were significantly higher in the Spirulina platensis group than in the control group of lambs (Hanafy, 2023). EL-Sabagh et al. (2014) indicated that supplementation of fattening lambs with Spirulina increased the total leukocyte count. Haemoglobin concentration and haematocrit, indicators of oxygen-carrying capacity, were higher in T3 than in the other groups at both time points. The mechanisms by which spirulina affects white blood cell counts and red blood cell parameters are not yet fully understood, but it may be that the biologically active components in spirulina stimulate white blood cell production or activity, especially when higher doses of spirulina are taken. However, more research is needed to understand the specific cell types and signalling pathways involved.

Immune response indicators

The results of the study show that spirulina can be included in the feed of lambs as an immunostimulant and growth-promoting supplement (EL-Sabagh et al. 2014). Spirulina as a feed additive (5 g/kg diet) could be safely used to improve the growth and health of ram lambs (Assar et al. 2023) and goats at 2 to 4 g Spirulina/head/day (Al-Yahyaey et al. 2022). El-Deeb et al. (2022) and Abd Eldaim et al. (2018) concluded that the addition of spirulina (0.5 and 1 g/10 kg body weight) to the ration of sheep positively influenced their health status and growth rate. The levels of pro-inflammatory cytokines, including IL-1, IL-6, IL-12, TNF-α and IFN-γ, remained unchanged in lambs receiving spirulina powder at both 35 and 70 days. This suggests that spirulina supplementation, at least at the levels tested, does not induce a significant inflammatory response in the lambs. Spirulina may modulate the immune system, possibly by influencing the production of pro-inflammatory cytokines such as IL-1β, IL-2, IL-8 and TNF-α (Ravi et al. 2010). These inflammatory cytokines mediate the inflammatory response in the animal body (Zhang et al. 2017). In addition, a study found that Spirulina platensis stimulates the production of IFN-γ and increases the phagocytic activity of immune cells triggered by IL-12 (Kawanishi et al. 2013). Increased TNF-α by administration of Spirulina platensis (Manikowska et al. 2014; Abd Eldaim et al. 2018;). In contrast, lambs fed 0.80% spirulina powder (T3) followed by 0.20 and 0.40% spirulina powder (T1 and T2) had the highest IL-2 levels at both 35 and 70 days. IL-2 is an important cytokine for the activation and proliferation of T lymphocytes (T cells) and plays a crucial role in the adaptive immune response of the immune system (Shi et al. 2020). This finding suggests that higher levels of spirulina could stimulate T cell activity, potentially improving the ability of lambs to respond to certain pathogens. However, the observed increase only occurred in the highest dose group, indicating a possible dose-dependent effect. T1-fed lambs had higher IL-4 levels at 35 days. IL-4 is a cytokine associated with the activation of Th2 cells and promotes anti-inflammatory responses (Mitchell et al. 2017). The inconsistent effect of spirulina on IL-4 levels across different doses and time points warrants further investigation. Interestingly, IL-10 levels were only affected by spirulina powder at 70 days, while no significant difference was found at 35 days compared to the control. IL-10 is a potent anti-inflammatory cytokine that contributes to the regulation of immune responses (Bazzoni et al. 2010). The delayed increase in IL-10 with spirulina supplementation could indicate a gradual modulation of the immune system towards an anti-inflammatory state. Spirulina may contain bioactive compounds that modulate the activity of immune cells or influence the pathways of cytokine production. Since spirulina can also influence the rumen bacteria, these changes in the gut microbiota could indirectly influence the immune system via complex signalling mechanisms.

Selected rumen microbiota activity

Study suggest that spirulina may be beneficial for ruminants in two ways, which could contribute to improved growth (Panjaitan et al. 2015). Firstly, it may reduce protein breakdown in the rumen, potentially making more protein available for absorption by the animal. Secondly, spirulina appears to influence the composition of rumen bacteria, which could promote the growth of beneficial bacteria that contribute to more efficient microbial protein synthesis. This combined effect could lead to increased overall protein availability for the animal. This study suggests that the addition of spirulina powder to the diet of lambs selectively influences the populations of certain rumen bacteria. Lambs fed T2 and T3 had a higher abundance of Butyrivibrio fibrisolvens compared to the CON group. This bacterium plays a crucial role in rumen fermentation, particularly in the breakdown of fibre and the production of butyric acid, an important source of energy for ruminants (Palevich et al. 2019). The increased abundance suggests that higher spirulina supplementation could improve fibre digestion and energy production in the rumen. Interestingly, the 0.20% spirulina group (T1) showed no significant difference in Butyrivibrio fibrisolvens compared to the CON group. This could indicate a dose-dependent effect of spirulina, where intermediate levels might not be optimal for promoting this specific bacterial population. The lambs fed spirulina powder (T1-T3) had higher quantities of Ruminococcus Albus, Ruminococcus Flavefaciens and Streptococcus Bovis compared to the control group. These bacteria contribute significantly to rumen fermentation by degrading cellulose, hemicellulose and other complex carbohydrates (Weimer, 2022). Their increased abundance suggests that spirulina supplementation may promote more efficient degradation of plant material in the rumen, possibly leading to improved nutrient utilisation by the lambs. On the other hand, the results suggest that spirulina may have a selective effect on certain bacterial populations such as Anaerovibrio Lipolytica, Fibrobacter Succinogenes, Selenomonas Ruminantium and total bacteria. The reasons for the selective effect of spirulina on rumen bacteria are not entirely clear, but potential explanation include spirulina is rich in proteins, vitamins, minerals and other bioactive compounds and thus components could selectively favour the growth of specific bacteria with particular nutritional requirements.

Morphology of the rumen tissue

The most popular method for assessing rumen development and health in lambs is morphometric rumen parameters, which include papilla height, width and density (Cui et al. 2019). In addition, papillae surface area reflects the enhanced of the surface for absorption of volatile fatty acids in ruminants (Suárez et al. 2006). The current results suggest that supplementing lambs’ diets with spirulina powder has a positive effect on certain aspects of their rumen papillae, possibly influencing digestive function (Lv et al. 2020). Lambs fed spirulina powder (T1-T3) had greater papilla height, density and total surface of papillae compared to the CON group. This indicates that feeding spirulina may promote the growth and elongation of rumen papillae in lambs, possibly resulting in a greater surface area for digestion of nutrients and absorption of volatile fatty acids (Wang et al. 2023). There were no significant differences in papilla width between the spirulina-fed groups and the control group. This indicates that spirulina supplementation primarily affects the height and density rather than the width of the papillae. Lambs fed 0.40% and 0.80% spirulina powder (T2 and T3) had a larger papilla surface area compared to the other treatment groups, including the control group. This finding is consistent with the increased papilla height observed in these groups, suggesting that spirulina promotes the expansion of intestinal villi, which could improve digestion and absorption efficiency. The specific mechanisms by which spirulina exerts these effects are not yet fully understood, but there are several possibilities. Spirulina is rich in various bioactive compounds, including phytonutrients, antioxidants and essential fatty acids. These compounds could stimulate cell proliferation and differentiation, leading to increased papilla height and density (Al-Musodi 2023). The other possibility modulates the composition of the gut microbiota, potentially favouring beneficial bacteria that contribute to rumen health and digestive function (Malmuthuge et al. 2019).

Conclusions

In conclusion, Spirulina platensis supplementation significantly improved the growth performance and immune response of lambs. This was reflected in increased weight gain and feed intake, a higher white blood cell counts and an increase in the levels of IL-2, IL-4 and IL-10 compared to the control group. In addition, spirulina increased specific beneficial rumen bacteria (Butyrivibrio fibrisolvens, Ruminocoocus Albus, Ruminococcus Flavefaciens, Streptococcus Bovis). Lambs fed Spirulina showed increased papilla height, density and total papilla surface area, potentially indicating improved digestive surface area and nutrient absorption.

Overall, the results of this study provide evidence that Spirulina platensis can improve some indicators of growth performance, immune response, hematological parameters, bacterial activity and rumen morphology in lambs. In addition, a dose-response relationship was observed for some parameters, with the medium (0.4%) and high dose (0.8%) showing greater benefits compared to the control and low dose (0.2%). However, further studies are needed to clarify the specific mechanisms and determine the most effective and safest dose of Spirulina platensis for lambs.

Ethical approval

The Scientific Ethics Committee of King Saud University in Saudi Arabia approved all procedures used in this study (internal reference number: KSU-SE-21–04).

Disclosure statement

There are no conflicts of interest associated with this publication by the author(s).

Data availability statement

All data presented in this study are available by all authors.

Additional information

Funding

The authors extend their appreciation to King Saud University, located in Riyadh, Saudi Arabia. The specific grant came from the Research Project Group (RSPD2024R833).