Indole-3-carbinol as a radiosensitizer and modulator of IR-dependent stemness in triple-negative breast cancer

ABSTRACT

Breast cancer (BC) is one of the most common malignant tumors among women worldwide that contributes to the high mortality rate among other malignancies. The resistance developed by cancer cells against different treatment strategies such as radiotherapy, inspired the researchers to use other products such as phytochemicals to sensitize cancer cells to therapy. This study is designed to evaluate the anti-cancer and/or radio-sensitizing effect of Indole-3-carbinol (I3C) on the triple negative breast cancer (TNBC) cell line MDA-MB-231. The concentration of I3C that is used as a radio-sensitizing dose was assessed using an MTT assay. Treatment of MDA-MB-231 cells with I3C and/or ionizing radiation led to significant downregulation at cell proliferation which was indicated by the decrease at colony formation ratio and reduction in Ki67 expression. The combined treatment showed upregulation of Bax and downregulation of Bcl-2 gene expression. Wound healing assay indicated the significant effect of combined treatment in reducing MDA-MB-231 cell motility, which was molecularly validated by significant downregulation at CD44, MMP-9 and VEGF transcripts levels. The combined therapy led to a significant reduction at the antioxidant enzyme levels as well as the Epithelial-mesenchymal transition indicated by downregulation of IR-dependent vimentin upregulation. The stemness markers Nanog and Sox2 were significantly downregulated in combined therapy compared to IR-only treatment. In conclusion, synchronized therapy showed a potential role in enhancing the cell responsiveness to IR therapy by ceasing cell proliferation, survival, metastasis and reversing IR-dependent induction of EMT, and stemness in TNBC cell line MDA-MB-231.

Graphical abstract

KEYWORDS:

• Breast cancer
• radiation
• Indole-3- carbinol
• stemness

Introduction

Breast cancer (BC) is one of the most common malignant tumors among women worldwide, which is one of the leading causes of cancer-related death in women [1]. Approximately 2.3 million new cases per year worldwide and 520,000 new cases per year are detected in Europe. Over 90% of cases are diagnosed at early stages of breast cancer [2]. Breast cancer varies in grades and stages and its aggressiveness is correlated to the expression of estrogen, progesterone and human epidermal growth factor receptor 2 (Her2) receptors on the cell membrane [3]. However, cancer treatment with surgery, chemotherapy, and radiotherapy were still limited to a high rate of reverse side effects [4]. Several studies clarified the major role of adjuvant radiotherapy as a standard clinical protocol due to its ability to improve locoregional recurrence rates and lower cancer-related mortality by care for women with early stage invasive breast cancer [5,6].

Radiotherapy (RT) is one of the most common non-surgical approaches that are used for treatment of some cancers. RT plays a main role in the therapeutic management of cancer disease in patients at both early-stage and local cases [7]. RT effectiveness is due to the high energy of ionizing radiation that impacts biological molecules, living cells, and tissues [8]. X-rays and Gamma rays are the most common forms of ionizing radiation that can strike and kill cancer cells through two mechanisms; direct action, by inducing a DNA single- or double-strand breakage, thus, halts the cancer cells repair mechanisms, and induces cell transition to death, and indirect effect, by initiating highly reactive hydroxyl radicals that increases the density and number of free radicals which leads to cell injury and death [9,10]. A high level of oxidative stress is considered a novel target for anti-cancer cure due to increasing exogenous reactive oxygen species (ROS) and/or antioxidant system inhibition [11]. Excessive amounts of ROS may also act as cellular toxicants, which can lead to cancer-cell growth arrest, apoptosis, and necrosis. It is speculated that malignant cells under increased levels of oxidative stress are more vulnerable to further ROS attacks [12]. In spite of the role of IR in upregulating the level of oxidative stress of kill cancer cells, accumulating evidences supported its profound role in inducing epithelial mesenchymal transition of non-stem cancer cells to acquire the phenotype of stemness and radioresistancy [13,14].

One of the mechanisms by which cancer cells can resist radiotherapy was due to its ability to downregulate pro-apoptotic P53 and Bax, and upregulate anti-apoptotic Bcl-2, TRAF2, and NF-_kB protein expression [15]. Moreover, Cancer cells have the ability to resist radiotherapy via activating DNA damage repair pathways, undergoing EMT and upregulating the expression of stemness markers such as Sox2 and Nanog [16]. Therefore, it is important to find a strategy to elevate the radiosensitivity of cancer cells while lowering their systematic reverse effect.

In the past two decades, numerous literatures clarified the anti-cancer activity of several phytochemicals that are naturally extracted from plants; highlighting them owing to their high potential as a possible alternative therapy that needs more consideration from oncologists [17]. Several literatures elucidated those phytochemicals to play an important role in cancer treatment due to their anti-inflammatory, antioxidants, anti-bacterial, and anti-fungal characteristics [18]. Recent report indicated the main role of phytochemicals in cancer treatment via targeting different pathways involved in cancer cell proliferation, survival, invasiveness and metastasis by downregulating Ki67, SVV, CD44, MMP9 expressions, respectively [19].

Indole-3-carbinol (I3C) is one of the phytochemicals that are naturally extracted from several cruciferous vegetables such as broccoli, kale, cabbage, Brussels sprouts, cauliflower, turnip, and collard greens [20,21]. I3C is produced by degradation of glucobrassicin A and is considered as one of the Indole-3-methyl isothiocyanate hydrolysis products [20,22]. Several studies referred to the major role of I3C in inhibiting breast cancer cell proliferation by targeting the NF-_kB pathway [22]. Some studies showed that I3C plays an important role in blocking estrogen receptors as an implicant of tamoxifen that used in treating estrogen-dependent tumors and preventing breast cancer cell proliferation [23]. A study by Odongo et al., proved that the combined treatment of I3C with actein, withaferin A, and CKI revealed its capacity to simultaneously regulate multiple processes of carcinogenesis in breast cancer [24]. Several reports indicated in vitro and in vivo effects of I3C in reducing cell proliferation, migration, and metastasis of MDA-MB-231 and MCF7 cells-derived xenograft mice [21,25].

The present study was designated to determine the potential therapeutic effect of I3C as a radiosensitizer on diminishing the progression of the triple negative breast cancer cell line MDA-MB-231 by targeting cell proliferation, invasion, survival and halting the IR-dependent increment at treated cells stemness and EMT.

Materials and methods

Chemicals and antibodies

• - MDA-MB-231 cell line was provided by Tissue culture lab, faculty of science/El-Mansoura university, Egypt., was cultured in DMEM (Dulbecco’s Modified Eagle Medium, biowest, Canada), supplemented with 10% FBS (Fetal Bovine Serum), and 1% pen/strep (penicillin/streptomycin, biowest, Canada, trypsin-EDTA 1X in solution w/o calcium, w/o magnesium, and w/Phenol Red). MDA-MB-231 cells were incubated with 5% Co₂ and 37°C. Harvesting was conducted by washing cells twice with PBS 1× (Phosphate Buffer Saline, biowest, Canada) followed by trypsinization using trypsin 0.25% at 37°C and 5% Co₂ for 2 minutes.

• - Natural plant extraction phytochemical (Indole-3-carbinol) was purchased from MedChemExpress (MCE), USA.

• - The anti-bodies included (Bax, Bcl-2, Ki67, Survivin (SVV), nuclear factor erythroid 2-related factor 2 (Nrf2), e-cadherin (e-cad), Vimentin (vim), vascular endothelial growth factor (VEGF), CD44, Nanog (a member of the homeobox family of DNA binding transcription factors, and the name derives from Tir Na Nog, the mythical Celtic land of youth), Sox2 (sex-determining region homeobox2) and GAPDH) were purchased from (Santa Cruz, CA, USA).

Cell line and cell culture

Proliferation assay (MTT assay)

MDA-MB-231 cells were seeded in a 96-well plate with 5 × 10⁵ cell/well in 100 µl of complete media (DMEM supplemented with 10% FBS and 1% pen/strep) in duplicates for each concentration and incubated at 37ºC and Co₂ 5% for 24 hr. different concentrations of I3C were prepared by serial dilution. Cells were incubated with descending concentrations of I3C (200 µg/ml, 100 µg/ml, 50 µg/ml, 25 µg/ml, 12.5 µg/ml, and 6.25 µg/ml) for 48 hr. untreated cells were considered as a negative control. The IC₅₀ of I3C and the inhibition of cell proliferation was evaluated by using MTT (3-[4,5-dimethylthiazol-2-yl]-2,5- diphenyltetrazolium bromide, 5 mg/ml), a 100 µl per well of MTT was added and incubated at 37°C and 5% Co₂ for 4 hr. Following the incubation, a 100 µl Sodium Lauryl Sulfate (SDS) was added to each well and incubated for 14 hr, the absorbance was measured at a wavelength of 570 nm using (Bio Tek, Elx800, US) [26]. The inhibition of cell proliferation was calculated from (Eq.):

$\mathit{Inibition}\left(\mathrm{\%}\right)=\mathit{Control}\left(\mathit{OD}\right)-\mathit{Sample}\left(\mathit{OD}\right)/\mathit{Control}\left(\mathit{OD}\right)\mathit{X}100\mathrm{\%}$

Where (O.D) is the optical density.

Data analysis was carried out using the Prism software program (GraphPad Prism 6).

Group designation

To evaluate the therapeutic potential of I3C with/without IR on MDA-MB-231 cells, cells were divided into four groups as follows: (a) The Control group (MDA-MB-231 cells without any treatment), (b) I3C group (cells treated with 58.82 µg/ml of I3C for 24 hr), (c) IR group (cells treated with single dose of 2 Gy of x-ray), (d) I3C + IR group (cells treated with 58.82 µg/ml of I3C for 24 hr, then exposed to single dose of 2 Gy of x-ray). The groups were designed to study the effect of I3C as radio-sensitizer by colony developed ratio, pro-apoptotic protein Bax, anti-apoptotic protein Bcl-2, the ability of cells migration by wound healing assay, CD44, MMP-9, Vegf Nrf2, Nanog and Sox2 genes expression, and the activity of oxidative enzymes (CAT, and GSH). The untreated group of MDA-MB-231 was considered a control group.

Clonogenic assay

MDA-MB-231 cells were seeded in T-75 flasks and incubated until 80% confluency, Afterwards, cells were pretreated with I3C for 24 hours, then exposed to a single dose of 2 Gy of x-ray irradiation, using a SHINVA® XHA600D medical linear accelerator (linac) and Prowess® panther 3D planning system as a radiation source. After irradiation, cells of each group were washed twice with 1× Phosphate Buffer Saline (PBS), and dissociated using trypsin. Cells were sub-cultured in triplicates in 6-well plate at seeding density of 1000 cells/well. After incubation for an additional 7 days, the surviving cells developed colonies countable by the naked eye. Cells were then fixed with 70% ice-cold ethanol and then stained with crystal violet. Colonies of at least 50 cells were counted. Survival factor and colony formation ratio were estimated for each group [27].

Migration assay (wound healing assay)

MDA-MB-231 cells were seeded in T-75 flasks and incubated till 80% confluency then pre-treated with I3C for 24 hr and irradiated. Cells were washed more than once with 1× PBS and trypsinization, the MDA-MB-231 treated cells were cultured in a 6-well plate with 25,000 cells/well and then incubated even completely confluence, a scratch with 1000 μL micro-pipette tip was induced diagonally in the middle of each plate. Afterward, the culture was washed twice with PBS to remove the undetached cells and then incubated for 24 hours. Microscopic photographs were taken using an inverted microscope at 0 and 20 hrs [28].

Quantitative reverse transcription polymerase chain reaction (RT-PCR) for evaluation of Ki67, Bax, Bcl2, CD44, SVV, MMP-9, VEGF, Nrf2, vim, e-cad, Nanog, and Sox2 transcriptional levels

Total RNA was extracted from MDA-MB-231 cells using the Trizol method according to the manufacturer’s instructions. The concentration and quality of extracted RNA were measured by the NanoDrop (ND-2000, USA). Complementary DNA was synthesized from 1 μg of total RNA using SensiFAST™ cDNA Synthesis Kit (Bioline, Australia) according to the manufacturer’s protocol. Determination of the expression levels was assessed using Maxima SYBR Green Kit according to the manufacturer’s protocol (Thermo Scientific, CA, USA) using the following primers: B-cell lymphoma protein 2-associated X (Bax) (Forward)5′-GGTTGTCGCCCTTTTCTA-3′, (Reverse) 5′-CGGAGGAAGTCCAATGTC-3′, B-cell lymphoma 2 (Bcl2): (Forward)5′-GATGTGATGCCTCTGCGAAG-3′, (Reverse) 5′-CATGCTGATGTCTCTGGAATCT-3′, cluster of differentiation 44 (CD44): (Forward)5′-TTTGCATTGCAGTCAACAGTC-3′, (Reverse) 5′-TTACACCCCAATCTTCATGTCCAC-3′, Matrix metallopeptidase 9 (MMP9): (Forward)5′-ATCCAGTTTGGTGTCGCGGAGC-3′, (Reverse) 5′-GAAGGGGAAGACGCACAGCT-3′, vascular endothelial growth factor (Vegf): (Forward)5′- TGCAGATTATGCGGATCAAACC-3′, (Reverse) 5′- TGCATTCACATTTGTTGTGCTGTAG-3′, Nuclear factor erythroid 2-related factor 2 (Nrf2): (Forward)5′- GCTATGGAGACACACTACTTGG-3′, (Reverse) 5′- CCAGGACTTACAGGCAATTCT-3′, Nanog: (Forward)5′- 5 -ATGCCTGTGATTTGT GGGCC-3′, (Reverse) 5′-GCCAGTTGTTTTTCTGCCAC-3′, sex-determining region homeobox2 (Sox2): (Forward)5′- GGATGGTTGTCTATTAACTT-3′, (Reverse) 5′- TCAAACTTCTCTCCCTTT-3′, Ki67: (Forward)5′- TCCTTTGGTGGGCACCTAAGACCTG-3′, (Reverse) 5′- TGATGGTTGAGGTCGTTCCTTGATG-3′, Survivin (SVV): (Forward)5′- TTTTGTGGCTTTGCTCTATTGT-3′, (Reverse) 5′- GGTAGGAGGACTCATCAGAAGGA-3′, Vimentin (Vim): (Forward)5′- AAAGTGTGGCTGCCAAGAAC-3′, (Reverse) 5′- AGCCTCAGAGAGGTCAGCAA-3′, E- cadherin (e-cad): (Forward)5′- TACGGGGGGCGGTGCTCCGG −3′, (Reverse) 5′- CTGGGGCGCGGAGCTTGCGG −3′, and Glyceraldehyde-3-phosphate dehydrogenase (GAPDH): (Forward) 5′-TGGCACCCCAGCACAATGAA-3′, (Reverse) 5′-CTAAGTCATAGTCCGCCTAGAAGCA-3′.

Thermal cycling conditions were conducted by initial heating step at 95 ◦C for 10 min. followed by 40 cycles at 95 ◦C for 30 s, annealing at 49 ◦C, 64 ◦C, and 51 ◦C for Bax, Bcl-2, KI67, SVV, MMP9, Vegf, Nrf2,Vim, e-cad, Nanog, Sox2 and GAPDH, respectively, for 30 s each and 72 ◦C for 1 min and final extension at 72 ◦C for 10 s. Relative expression of the targeted genes were normalized against GAPDH transcript as an internal reference control and then calculated according to the mathematical model introduced by M Pfaffl 2^−ΔΔCt [29].

Assessment of oxidative stress biomarkers

MDA-MB-231 cells were treated with I3C for 24 hours and irradiated with 2 Gy x-ray, cells were washed with 1× PBS and trypsinization then kept with 1 ml of 1× PBS in −20°C till use. ELISA technique was used to determine the Catalase (CAT) and Glutathione Synthesis (GSH) antioxidants according to the kit instructions (Biodiagnostic and research reagents, Giza, Egypt).

Statistical analyses

The data was statistically analyzed using the statistical software GraphPad Prism program (V.6). mean value and standard deviation were calculated. The mean differences were acquired by One-way ANOVA analysis. The results were expressed as mean ± standard error of the mean value (Mean ± SEM) and used at least 3 values for the samples (n = 3).

Results

Determination of I3C IC₅₀

The sensitivity of MDA-MB-231 to I3C was first evaluated by the MTT colorimetric method which is a useful tool for assessing cell proliferation, cytotoxicity, and cellular metabolic activity against the log of [I3C doses individually] as illustrated in (Figure 1a). The data analysis indicated that the IC₅₀ of I3C was 58.82 µg/mL. So, the dose of 58.82 µg/mL, and 2 Gy x-ray for I3C, and ionizing radiation (IR), respectively, were chosen for radio-sensitizing studies.

Figure 1. Anti proliferative effect of IR and/or I3C on MDA-MD-231 cell line. (a) MTT assay indicated the cytoxicity of I3C and the IC50 was calculated (58.82 μg/ml). (b) The combined therapy significantly downregulated the expression of the tumor proliferation marker Ki67 compared to I3C and IR, where the cells were pretreated with I3C for 24 hr before exposure to IR. (c) Colony formation assay revealed the significant effect of combined therapy in diminishing cell proliferation compare to control group and IR. Significance was denoted *as p < 0.05 as compared to control and significance was denoted $ as p < 0.05 as compared to IR. Significance was denoted *as p < 0.05 as compared to control and significance was denoted $ as p < 0.05 as compared to IR.

Effect of I3C with/without IR on MDA-MB-231 cells proliferation and survival

Effect of I3C with/without IR on MDA-MB-231 cells colony formation ratio

To evaluate the radio-sensitizing effect of I3C, and/or IR, MDA-MB-231 cells were irradiated with a single dose of 2 Gy of X-rays, due to its relevance to the cumulative dose used in human conventional radiotherapy as a routine protocol, and it also showed a significant effect on clonogenic assay, in the presence and absence of 58.82 µg/mL of I3C. The number of developed colonies was assessed after 7 days of incubation. The data reached a significant reduction in colony formation number by 24-hour sensitization of the cells with I3C (58.82 µg/mL) (Figure 1b,c). The significant reduction in the ratio of developed colonies for I3C treatment compared to the control group highlighted the anti-growth and anti-survival effect of the combination on MDA-MB-231 cells (Figure 1b,c). The present data showed a significant reduction in the number of colony formation in all treated groups I3C, IR, and I3C + IR by (172.66 ± 1.45, 304.66 ± 5.17, 162.66 ± 4.63), respectively, as compared to the control group (408.33 ± 4.41) p < 0.05, respectively, (Figure 1b,c). Remarkably, the treatment with I3C and I3C + IR viewed a significant reduction in the developed colonies ratio as compared with IR treatment (Figure 1b,c).

Impact of I3C, and/or IR on cell proliferation

To elucidate the impact of I3C, with/without IR by using the RT-PCR technique to evaluate Ki67 expression as a proliferation marker, MDA-MB-231 cells treated with I3C, IR, and I3C + IR. The data revealed a significant increase in Ki67 level expression when cells are treated with I3C, and IR (7.896 ± 0.029, 1.847 ± 0.023, p < 0.05, respectively), One the other hand, the combined therapy achieved a significant reduction in Ki67 expression (0.158 ± 0.026), compared to the control group (1 ± 0.058). On the other hand, data expressed a significant elevation in Ki67 level when cells were treated with I3C, and a significant decrease in Ki67 expression when cells were treated with combined therapy as a comparison to IR treatment (Figure 1d).

I3C, and/or IR treatment induce cell apoptosis on MDA-MB-231 cells

Apoptosis was evaluated by RT-PCR technique that was designed to assess the expression levels of pro-apoptotic protein Bax and the anti-apoptotic protein Bcl-2 in MDA-MB-231 cells. The analyzed data referred to a significant increase in the level of Bax gene expression when MDA-MB-231 cells treated with I3C, IR, and I3C + IR for 24hrs (1.74 ± 0.029, 1.947 ± 0.048, 4.05 ± 0.104, p < 0.05, respectively) 24hrs when compared to the control group (1 ± 0.058) (Figure 2a). On the other hand, combined treatment showed a significant increase in the level of Bax expression as compared with IR treatment (Figure 2a). The data illustrated a significant decrease of Bcl-2 expression levels in MDA-MB-231 cells treated with I3C, and I3C + IR (0.42 ± 0.012, 0.349 ± 0.023, p < 0.05, respectively), while groups treated with IR, revealed significant increase of Bcl-2 expression levels (6.409 ± 0.115) after 24 hr of treatment as compared to the control group (1 ± 0.058), p < 0.05, (Figure 2b). I3C, and combined treatment on MDA-MB-231 cells indicated a significant decrease on Bcl-2 levels as compared to IR treatment (Figure 2b).

Figure 2. Anti apoptotic effect of IR and/or I3C on MDA-MD-231 cell line. (a) the cell treatment with I3C and/or IR significantly upregulated the expression of Bax compared to the control group. (b) The cell treatment with I3C and combined significantly downregulated the expression of Bcl2. Meanwhile IR significantly upregulated Bcl2 expression compared to the control. (c)The statistical analysis of Bax/Bcl2 ratio pointed out the significant proapoptotic effect of combined therapy, IR and I3C compared to control group, respectively. The combined therapy significantly upregulated Bax/Bcl2 ratio compared to IR group. (d) The I3C, combined therapy and IR significantly downregulated the expression of the anti apoptotic SVV compared to the control group, respectively. Significance was denoted *as p < 0.05 as compared to control and significance was denoted $ as p < 0.05 as compared to IR.

Interestingly, the index of Bax/Bcl-2 ratio data confirmed the apoptotic therapeutic effect of I3C, and/or IR on MDA-MB-231 cells, the data showed a significant elevation at the levels of expression of Bax against Bcl-2 with a synergistic effect on MDA-MB-231 cells treated with I3C, IR, and I3C + IR for 24 hr of treatment with expression levels of (1.741 ± 0.17, 2 ± 0.006, 4 ± 0.153) compared to untreated cells group (1 ± 0.058), p < 0.05 (Figure 2c). Combined therapy revealed a significant increase in the Bax expression level versus Bcl-2 when compared with IR treatment.

The data elucidated a significant decrease in SVV (anti apoptotic marker) expression levels when cells treated with I3C, IR, and combined treatment (152 ± 0.023, 0.678 ± 0.021, 0.473 ± 0.015, p < 0.05, respectively), as compared to the control group (1 ± 0.058). Besides, the data expressed a significant decrease in SVV levels of MDA-MB-231 cells treated with I3C and combined therapy in comparison with IR-treated cells (Figure 2d).

Effect of I3C, and/or IR on MDA-MB-231 cell motility

Functional validation of I3C and/or IR effect on cell migration

The effect of I3C, with/without IR on MDA-MB-231 cell motility was tested by measuring the migration ability of treated cells to migrate following a mechanically induced wound in the culture plate, whereas the increase at wound size clarifies an inhibition at cell migration capability. Evaluation of the size of the space after 24hrs of treatment showed a significant effect of IR, and I3C + IR by (270.66 ± 12.979, 526.66 ± 49.008, p < 0.05) as compared to the control group (0 ± 0.0), respectively, in lessening the MDA-MB-231 cells motility compared with control cells which migrated into the space and healed the induced wound after 20 hr of starting the experiment (Figures 3a,b).

Figure 3. Anti metastatic effect of IR and/or I3C on MDA-MD-231 cell line. (a–b) Wound healing assay indicated the significant effect of IR and combined therapy in increasing the wound size compared to control group. (c–d) Molecular validation of antimetastatic effect of IR and/or I3C showed a significant upregulation at CD44 and Vegf and downregulation at MMP9 in IR group compared to control. The combined therapy significantly downregulated CD44, MMP9 and Vegf expressions in comparison with IR and control groups. Significance was denoted *as p < 0.05 as compared to control and significance was denoted $ as p < 0.05 as compared to IR.

Interestingly, the data pointed out a significant effect of combined therapy in lowering the cell’s motility compared with IR treatment (Figure 3a,b).

Molecular validation of the inhibitory effect of combined therapy on MDA-MB-231 cells metastasis by targeting CD44, MMP-9 and Vegf genes expression

The impact of I3C, with/without IR was evaluated by RT-PCR technique, and the collected data suggested that MDA-MB-231 cells exposure to I3C, and IR significantly increased the expression of CD44 (1.678 ± 0.26, 6.409 ± 0.173, p < 0.05, respectively), while the combined treatment showed no significant decreased on CD44 expression by (0.677 ± 0.012) as compared to control group (1 ± 0.058). I3C and combined therapy observed a significant decrease in CD44 expression when compared to IR treatment (Figure 3c).

In addition, the effect of I3C, IR, and I3C + IR on MDA-MB-231 cells induced a significant decrease in MMP-9 gene expression when treated with I3C, IR, and dual treatment (0.25 ± 0.02, 0.466 ± 0.18, 0.116 ± 0.15, p < 0.05, respectively), as compared to the control group (1 ± 0.058). Moreover, I3C, and I3C plus IR treatment revealed a significant decrease in MMP-9 expression level compared to IR treatment (Figure 3d).

RT-PCR technique was used to evaluate the expression of vim, VEGF, and e-cad as tumor markers for metastasis in cancer cells. MDA-MB-231 cells were treated with I3C, IR, and I3C + IR. The data reported a significant decrease in VEGF expression in cells treated with I3C, and I3C plus IR by (0.128 ± 0.015, 0.23 ± 0.023), p < 0.05, respectively, while IR treatment revealed a significant increase in VEGF expression recorded (1.44 ± 0.029), p < 0.05, as compared to the control group (1 ± 0.058). Besides, the treatment with I3C and combined therapy showed a significant decrease in VEGF expression in comparison to IR treatment (Figure 3e).

Impact of I3C, and/or IR on the antioxidant machinery of MDA-MB-231

MDA-MB-231 cells were exposed to I3C, and/or IR for 24hrs, the data revealed a significant decrease of Nrf2 levels when cells treated with I3C by (0.428 ± 0.24), p < 0.05, while treatment with IR revealed a significant increase in Nrf2 expression recorded (7.963 ± 0.39), p < 0.05, besides, the combined treatment showed a non-significant effect on Nrf2 gene levels recorded (0.99 ± 0.42), p < 0.05, as compared to the control group (1 ± 0.058). Remarkably, the data showed a significant reduction in Nrf2 gene levels on MDA-MB-231 cells when treated with I3C, and combined therapy in comparison with IR treatment (Figure 4a).

Figure 4. (a–c) The role of IR and/or I3C therapy in cellular antioxidant capacity. The IR therapy significantly upregulated the expression of Nrf2 with non significant effect on CAT and GSH expression. The combined therapy significantly downregulated Nrf2 expression. (d–f) Effect of IR and/or I3C on EMT. The combined therapy significantly upregulated E-cadherin expression and downregulated vimentin expression compared to IR group. (g–h) Effect of IR and/or I3C on cell stemness. The IR treatment significantly upregulated the expression of Sox2 and Nanog compared to control group. The combined therapy significantly over countered this effect. Significance was denoted * as p < 0.05 as compared to control and significance was denoted $ as p < 0.05 as compared to IR.

Furthermore, the data expressed a significant decrease in the antioxidant enzyme CAT when cells treated with I3C, IR, and I3C + IR by recorded (33.095 ± 0.85, 7.545 ± 1, 16.913 ± 1), p < 0.05, respectively, when compared with untreated control group (348.286 ± 0.3). On the other hand, I3C, and dual therapy indicated a significant elevation in CAT activity compared to IR treatment (Figure 4b). By the way, the activity of GSH enzyme reached a significant decrease when MDA-MB-231 cells treated with I3C, IR, and I3C + IR which recorded (26.894 ± 0.85, 7.608 ± 0.7, 6.57 ± 0.9), p < 0.05, respectively, as compared to control group (596.946 ± 5.1), p < 0.05, while the data observed a significant increased on GSH activity on cells treated with I3C compared to IR treatment (Figure 4c).

Evaluation of the effect of I3C, IR, and combined treatment on MDA-MB-231 cells EMT gene expression

The effect of I3C, and/or IR on EMT markers of MDA-MB-231 cells was assessed using the RT-PCR method. The data observed a significant decrease in e-cad gene expression on cells treated with I3C, IR, and combined therapy recorded (0.11 ± 0.0006, 0.129 ± 0.018, 0.138 ± 0.012), p < 0.05, respectively, as compared to control group (1 ± 0.058). The data showed a significant reduction in e-cad expression in cells treated with I3C, with no significant effect on cells treated with combined therapy in comparison with IR-treated cells (Figure 4d). On the other hand, the data marked a significant decrease in vim gene expression when cells treated with I3C, IR, and I3C plus IR recorded (0.136 ± 0.012, 0.737 ± 0.021, 0.232 ± 0.017), p < 0.05, respectively, as compared to control group (1 ± 0.58). The treatment with I3C and combined therapy showed a significant decrease in the level of vim expression as compared to the IR-treated group (Figure 4e).

The index of the e-cad/Vim ratio revealed a significant decrease at e-cad levels versus vim levels as compared to the control group, (Figure 4f).

Effect of I3C, and/or IR on MDA-MB-231 cell stemness

To estimate the therapeutic potential effect on pluripotent Nanog, and Sox2 as stemness biomarkers, MDA-MB-231 cells treated with I3C, IR, and I3C plus IR. The data reached a significant decrease in the Nanog expression when cells treated with I3C, and I3C + IR recorded (0.426 ± 0.019, 0.614 ± 0.006), p < 0.05, respectively, while treatment with IR alone revealed a significant increase in the level of Nanog expression by (1.417 ± 0.017), p < 0.05, as compared to the control group (1 ± 0.058), p < 0.05 (Figure 4g) observable, I3C and combined treatment pointed to a significant decrease in Nanog expression level compared to IR treatment (Figure 4g).

On the other hand, the data expressed a significant decrease in Sox2 level expression when cells treated with I3C recorded (0.265 ± 0.015), p < 0.05, while data proved a significant increase in the Sox2 expression with IR treatment by (3.804 ± 0.046), p < 0.05, the combined treatment on MDA-MB-231 cells revealed no significant elevation on Sox2 gene expression by (1.75 ± 0.015), p < 0.05, as compared to control group (1 ± 0.058), p < 0.05 (Figure 4h). Remarkable, the data reached the cells treated with I3C, and dual treatment indicated a significant decrease in Sox2 expression levels compared to IR treatment (Figure 4h).

Discussion

Radio-resistance developed by highly invasive cancers is still a major delinquent that tackles the radiotherapists worldwide [19]. Despite the numerous reports that illustrated the high therapeutic potential of phytochemicals in cancer treatment, their implication in clinical protocols is still limited because of their low bioavailable levels [30]. For this reason, the implication of phytochemicals in adjuvant and neoadjuvant therapy to overcome its low bioavailability was developed to target cancer cell proliferation, survival, and metastasis [31].

In this article, we aimed at estimating the proposition of using I3C as a radiosensitizer, to enhance MDA-MB-231 cells’ responsiveness to radiotherapy by reducing their proliferation, survival, metastasis and IR dependent EMT and stemness. In addition, the anti-cancer characteristics of I3C were tested as well.

Several literatures clarified the potentiality of I3C in targeting different cancer cells such as liver and breast cancers either solitary or in combined therapy [21,22]. However, its impact as radiosensitizer in breast cancer is still unclear and not fully understood. To investigate the anti-cancer and the possible radio-sensitizing effects of I3C, the IC₅₀ of I3C was first calculated and a dose of (58.82 µg/mL) was selected for further radio-sensitizing studies as it was the dose that induced a significant inhibition at cell proliferation with enough number of cells remains for clonogenic assay after irradiation (Figure 1a). The significant decrease in the developed colony ratio in I3C + IR treatment compared to its representable dose of IR (2 Gy) treated MDA-MB-231 cells as well as untreated cells (control group) elucidated the adjuvant inhibitory effect of I3C plus IR on breast cancer cell growth (Figure 1b,c). Moreover, the anti-proliferative effect of I3C combined with IR revealed a significant downregulation at proliferation marker Ki67 (Figure 1d).

The role of Ki67 as a cell cycle marker and a prognostic factor for breast cancer progression was illustrated by several literatures [32]. Several literatures clarified the positive correlation of CD44 and Ki67 with tumor grades [33]. Besides, Nemours reports clarified the correlation between Nrf2 and Ki67, whereas Nrf2 downregulation or elevation led to decrease or increase at Ki67 expression, respectively [34].

The role of phytochemical such as I3C or its diverts [3,3’-diindolylmethane (DIM)] as an adjuvant approach to conventional chemo- and radiotherapies for murine breast adenocarcinoma and prostate cancer was stated by several studies [35,36]. A study by Zamanian et al., proved that combined therapy of glioblastoma (U87MG cell line) with conventional IR (2 Gy) dose and genistein (50 µM) gave the highest significant effect on inhibiting cells proliferation and colony formation ratio compared to 2 Gy and fractionated doses [37].

In order to investigate the proapoptotic effect of I3C on MDA-MB-231 cells, the treated cells showed significant upregulation at Bax gene expression and downregulation of Bcl-2 gene expression in combined treatment compared with either I3C and IR which indicated the potent proapoptotic effect of adjuvant therapy (Figure 2a–c).

I3C significantly stimulated P53-dependent apoptosis pathway in treated ovarian, Lung and adeno gastro carcinoma cancer cells [38,39]. The proapoptotic effect of adjuvant therapy was further validated by the significant diminishment at SVV expression compared to IR and control groups (Figure 2d) The antiapoptotic effect of SVV, as IAP family member, is an established fact and its expression in controllable by several upstream proteins such as CD44/E2F1/SVV pathway [40].

Furthermore, the anti-metastatic effect of IR and I3C plus IR treatment was structurally validated by the significant increase at the wound size compared to control group in wound healing assay (Figure 3a,b). Furthermore, these results were molecularly confirmed by the significant decrease at the expression of CD44 and its downstream targets MMP9 and Vegf expressions in combined therapy compared to control and IR-treated groups. Interestingly in IR group, the transcription of CD44 and its downstream target Vegf were significantly upregulated compared to control; whereas MMP9 transcription was elevated compared to combined therapy (Figure 3c).

Recent publication illustrated the role of IR in uprising the expression of CD44 by activating-RAS/ERK signaling as one of the underlying mechanisms of radioresistance [41]. A study on the expression patterns of genes that were highly expressed in radioresistant colorectal cancer RKO cells; indicated CD44 as one of the top five targeted genes [42].

The role of CD44 in signaling for neo-angiogenesis in breast cancer was illustrated by its novel role in upregulating MMP9 expression which in turn sheds the CD146 ectodomain from cell membrane. The upraise at soluble CD146 signals for VEGF overexpression and new blood vessels formation in CD44/sCD146/VEGF pathway [43].

A study by Abd Elhakeem et al., clarified the role of MMP-9 in tumor invasiveness, malignancy, or recurrence for brain anaplastic meningiomas [44]. In prostate cancer, a decrease at the surface expression of CD44 was recorded in MMP-9 knocked-down PC3 cells. Meanwhile, a decrease at the activation of MMP-9 was indicated as well in cells null for CD44 [45]. In addition, the downregulation of MMP-9 protein expression in PC3 cells switched CD44 isoform expression from CD44s to CD44v6 which is more glycosylated [46]. A study by Ludwig and colleagues elucidated that the activation of the HA-CD44 pathway led to the elevation of VEGF and MMP-9 by endothelial cells (ECs) to induced EMT and activate invasion during cancer progression [47].

Furthermore, CD44 was found to play a possible role in signaling for epithelial-mesenchymal transition (EMT) and stemness in MDA-MB-231 cells. The downregulation at CD44 transcription upon treatment may lead to Nrf2 downregulation, which in turn led to significant elevation of e-cad and reduction at Vim genes transcription. On the other hand, the role of adjuvant therapy in downregulating the treated cells antioxidant capacity was indicated by the significant downregulation at Nrf2 transcription and antioxidant enzymes CAT and GSH expression levels compared to IR and control groups, respectively.

Overstimulation of cellular antioxidant activity via upregulating NrF2 expression is a vital approach that cancer cells developed to resist cell apoptosis [11]. Interestingly, the adjuvant therapy significantly succeeded in opposing the IR dependent upraise at Nrf2 expression and its downstream targets antioxidant enzymes CAT and GSH, indicated its profound effect in targeting the antioxidant defense mechanism that cancer cells developed to resist radiotherapy (Figure 4a–c). Overexpression of Nrf2 is one of the cytoprotective mechanisms that cancer cells developed to evade cell death [48]. [49], illustrated the role of IR in elevating Nrf2 expression in breast cancer treated cells which in turn increased their resistance to radiotherapy in a negative feedback mechanism [49].

The activation of P53 dependent apoptosis requires an accumulation of Reactive oxygen species which seems to prevent the transactivation of Nrf2 [50]. The overexpression of Nrf2 and Svv was significantly associated with lymph node and distant metastasis in esophageal squamous cell carcinoma which was negatively correlated with the presence of immune-infiltrating cells in sectioned tumors [51].

The expression of Nrf2 was found to be regulated by the expression of CD44. The high level of the CD44 (Hyaluronic acid receptor) mediated the chemoresistance of doxorubicin resistant breast cancer cell line MCF7-DR by elevation of Nrf2 expression; whereas, silencing of Hyaluronic acid synthase-2 or CD44 led to inhibition of Nrf2 signaling with significant enhancement in cell responsiveness to chemotherapy [52]. Double targeting of autophagic and Nrf2-signaling pathways with selective chemical inhibitors, increases the response of oral CD44⁺ cancer cells to cisplatin cytotoxicity [53].

Interestingly, the combined therapy significantly over countered the IR effect in provoking the EMT by downregulating e-cad/Vim ratio compared to control cells which may be mediated by CD44 and Nrf2 overexpression (Figure 4d–f). The role of IR in promoting EMT was illustrated by several literatures which indicated that cancer cells survive the radiotherapy by enters EMT [14,54]. The CD44 expression significantly signals for EMT by activating TGF-β/Smad signaling, which enhanced EMT [55]. In colon cancer, the expression of the variant CD44v6 positively correlated with vimentin expression and inversely correlated with E-cadherin expression [56]. Recent publications illustrated the role of ionizing radiation in upregulating the expression of CD44 and Nrf2 in breast cancer [57].

Finally, we were interested in testing the impact of combined therapy on cancer cell stemness and the data revealed its effect on tackling on of the major disadvantage at cancer therapy. The adjuvant therapy significantly downregulated the expression of the stem cell markers Sox2 and Nanog compared to IR group which significantly upregulated their expression (Figure 4g,h). Recent literatures elucidated the implication of IR in upregulating the cancer cell stemness markers Oct4, Sox2, and Nanog mediated by the upregulation of CD44 [58].

Several literatures proved the phytochemicals’ role in downregulating the stemness markers Nanog and Sox2 expression and reduced cancer cell proliferation, invasion, and survival [59,60]. In breast cancer and Pancreatic cancer, several literatures highlighted the high accumulation of ROS due to the reduction at antioxidant enzymes inhibits cell proliferation, colony development, metastasis, stemness, and EMT [61,62].

In summary, the present study demonstrated, to-the-best of our knowledge, for the first time I3C as a radiosensitizer that enhances the MDA-MB-231 cell responsiveness to IR to diminish cell proliferation, migration, and survival as well as I3C significantly over countered the IR dependent increment at MDA-MB-231 EMT and stemness. Thus, suggesting this adjuvant therapy as a potential therapeutic strategy for breast cancer, to be considered for application in future clinical trials.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Correction Statement

This article has been corrected with minor changes. These changes do not impact the academic content of the article.