Interleukin 1 Receptor Antagonist and Tumor Necrosis Factor-α Gene Polymorphism in Patients with End-Stage Renal Failure

Abstract

End-stage-renal disease (ESRD) is a final result of various etiologies. Prognostic indicators leading to ESRD in chronic kidney diseases have been studied extensively, of which, genetic factors remain a subject of great concern. Interleukin-1 (IL-1) and tumor necrosis factor-α (TNF-α) are potent proinflammatory cytokines that are involved in several chronic kidney diseases. Studies on cytokine gene polymorphism have revealed important information about the role of genetic factors in disease susceptibility and severity. Gene polymorphism of interleukin-1 receptor antagonist (IL-1ra) and TNF-α were determined in 297 ESRD patients and in 145 normal healthy controls. IL-1ra gene polymorphism was characterized as a variable number of tandem repeats of a 86 bp sequence within intron 2. Five alleles were identified and were designated as IL1RN^*1, IL1RN^*2, IL1RN^*3, IL1RN^*4, and IL1RN^*5, corresponding to 4,2,5,3, and 6 repeats, respectively. A polymorphism in the promoter region of the TNF-α gene was also studied. This polymorphism involved a guanidine to adenosine transition at position − 308 and was designated as TNF1 (− 308 G) and TNF2 (− 308 A). The genotypes and allele frequencies were compared between patients and control group. The distributions of genotypes of IL-1ra and TNF-α did not differ significantly between ESRD patients and normal controls. Analysis of allele frequencies revealed a trend toward an increase in IL1RN^*2 frequency (7.5% versus 3.8 %, p = 0.064) and noncarriage of TNF2 in the patient group (7.2% versus 11.0%, p = 0.076) when compared with the control group. When both alleles were considered together, the patient group had a significantly higher frequency of carriage of IL1RN^*2 in combination with noncarriage of TNF2 (p = 0.0468). We conclude that carriage of IL-1RN^*2 and noncarriage of TNF2 allele appear to be poor prognostic factors in patients suffering from various chronic renal diseases that eventually enter end-stage renal failure.

• interleukin-1
• interleukin-1 receptor antagonist
• tumor necrosis factor-α
• genetic polymorphism
• chronic kidney disease
• end-stage renal disease

Introduction

The incidence and prevalence of end-stage renal disease (ESRD) are increasing in Taiwan as well as in most countries worldwide.[1] To combat this public health problem, it is important to search for prognostic indicators that lead to ESRD in various chronic kidney diseases. Genetic factors are usually implicated in the pathogenesis and prognosis in disease process. Studies of genetic polymorphism may identify individuals who are more susceptible to certain diseases or prone to disease progression. Interleukin-1 (IL-1) is a proinflammatory cytokine that participates in the pathogenesis of several renal diseases.[2] Interleukin-1 receptor antagonist (IL-1ra) is a potent anti-inflammatory agent that specifically inhibits the action of IL-1. In experimental study, IL-1ra is capable of suppressing crescentic glomerulonephritis.[3] Alteration of IL-1ra secretion secondary to genetic polymorphism has been found to affect disease susceptibility and disease activity in several inflammatory diseases.[4-6] The polymorphism is caused by a variable number tandem repeat of an 86 bp sequence in intron 2.[7] Five alleles were identified and were designated as IL1RN^*1, IL1RN^*2, IL1RN^*3, IL1RN^*4, and IL1RN^*5, corresponding to 4,2,5,3, and 6 repeats, respectively.[7]

TNF-α was originally discovered as a serum factor that causes tumor necrosis in mice.[8] TNF-α is a pleiotropic cytokine that has been implicated in chronic renal diseases.[2] The TNF-α gene is highly variable, andseveral mutations have been documented, of which, the polymorphism involving a guanidine (G) to adenosine (A) transition at the promoter region (− 308) is the most frequently studied.[9] The two alleles are TNF1 (− 308 G) and TNF2 (− 308 A). Enhanced TNF-α gene transcription has been demonstrated in individuals carrying TNF2 allele[10] and has been reported to be associated with increased disease activity.[6], [11] The aim of this study was to examine if IL-1ra and TNF-α genotypes and allele frequencies would be different in ESRD patients as compared to normal controls.

Material and Methods

ESRD patients who were on our waiting list of renal transplantation were recruited for the study. The etiologies of ESRD were variable and are shown in Table 1. The diagnosis was mainly based on clinical evaluation and, when possible, was supported by kidney biopsy. In a large proportion of patients (43.1%) the etiology was unknown, because these patients presented with advanced renal failure and contracted kidneys, hence no biopsy was performed. The most prevalent cause of ESRD was chronic glomerulonephritis (38.4%). Healthy subjects with comparable age and sex distribution were selected as normal controls.

Table 1. Underlying Renal Diseases of Patients (n = 297).

Underlying disease	N	%
Chronic glomerulonephritis	114	38.4
Chronic tubulointerstitial disease	16	5.4
Diabetes mellitus	11	3.7
Polycystic kidney disease	5	1.7
Obstructive uropathy	5	1.7
Hypertension	5	1.7
Systemic lupus erythematosus	4	1.3
Hereditary nephritis	4	1.3
Gouty nephropathy	4	1.3
Cystinosis	1	0.3
Unknown	128	43.1
Total	297

Polymerase Chain Reaction

Genomic DNA was extracted from peripheral blood mononuclear cells of both patients and controls. IL-1ra and TNF-α gene polymorphism were studied using previously described methods.[6] Briefly, the polymerase chain reaction (PCR) consisted of denaturing at 94°C for 2 min, then 30 cycles at 94°C for 30 sec, 60°C for 30 sec, and 72°C for 45 sec, and a final extension at 72°C for 5 min. The following primers were used: IL-1ra, 5′CTCAGCAACACTCCTAT3′ and 5′CCTGGTCTGCAGGTAA3′, TNF-α, 5′AGGCAATAGGTTTTGAGGGCCAT3′ and 5′TCCTCCCTGCTCCGATTCCG3′. The PCR products for IL-1ra were analyzed by electrophoresis on 2% agarose gels and stained with ethidium bromide for visualization under ultraviolet (UV) light. The polymorphism was based on the number of repeats of an 86 bp sequence[7] and designated as IL1RN^*1 (four repeats, 410 bp), IL1RN^*2 (two repeats, 240 bp), IL1RN^*3 (five repeats, 500 bp), IL1RN^*4 (three repeats, 325 bp), and IL1RN^*5 (six repeats, 595 bp). PCR products for TNF-α were digested with NcoI (NEB) at 37°C overnight and analyzed on 4% NuSieve 3:1 agarose gels (FMC bioproducts, Rockland, ME, USA). The polymorphism was designated as TNF1 (− 308 G), which gave two fragments of 87 bp and 20 bp, and TNF2 (− 308 A), which gave a single 107 bp fragment.[9]

Statistics

Allele frequency was calculated as the number of occurrences of the test allele in the population divided by the total number of alleles (i.e., twice the total case number) and expressed as a percentage. Comparisons of allele frequencies and genotypes between controls and patients were performed by chi-square test. A Bonferroni correction was performed for multiple comparisons. The odds ratio and 95% confidence interval (CI) were also calculated.

Results

A total of 297 patients (male : female = 176:121) was studied. The mean age was 37.9 ± 11.0 years (range: 10–66 years). The genotype distribution of IL-1ra and TNF-α genes in normal controls and patients is shown in Table 2. The observed distribution of homozygotes and heterozygotes conformed to Hardy–Weinberg expectations. There were no significant differences in any of the genotypes between patients and controls, although there was a higher percentage of IL1RN^*1/IL1RN^*2 in the patient group (13.1%) when compared with the control group (6.3%) (odds ratio: 2.25, with 95% CI: 1.03–4.91). The allele frequencies of IL-1ra and TNF-α in normal controls and patients are shown in Table 3. There was a trend toward an increased frequency of IL1RN^*2 (odds ratio: 2.03, 95% CI: 1.01–4.08, p = 0.064) and noncarriage of TNF2 in the patients (odds ratio: 0.63, 95% CI: 0.39–1.02, p = 0.076). When both alleles (IL1RN^*2 and TNF2) were considered together, the patients were stratified into three groups with respect to different combinations of IL1RN^*2 and TNF2. The combination of IL1RN^*2 +thinsp;/TNF2 − represents a “high-risk” group; the IL1RN^*2 + /TNF2 + or IL1RN^*2 − /TNF2 − combinations represent a “medium-risk” group, while the IL1RN^*2 − /TNF2 + combination represents a “low-risk”" group. A statistically significant higher proportion of patients showed a combination of IL1RN^*2 + /TNF2 − (p = 0.0468) when compared with normal controls (Table 4).

Table 2. Distribution of Genotypes in Controls and Patients.

	Control (n = 145)	Patient (n = 297)	Odds ratio (95% CI)	P value
IL-1ra				0.151
IL-1RN^*1/IL1RN^*1	91.7	85.5	1.00
IL-1RN^*1/IL1RN^*2	6.3	13.1	2.25 (1.03–4.91)
IL-1RN^*2/IL1RN^*2	0.7	0.9	1.40 (0.13–15.56)
IL-1RN^*1/IL1RN^*4	1.4	0.5	0.35 (0.03–3.89)
TNF-α				0.122
TNF1/TNF1	80.7	86.3	1.00
TNF1/TNF2	16.6	13.1	0.74 (0.42–1.29)
TNF2/TNF2	2.8	0.7	0.23 (0.04–1.29)

Data for genotype distribution are expressed as percentages.

Table 3. Allele Frequencies in Controls and Patients.

Allele	Control (n = 290)	Patient (n = 594)	Odds ratio (95% CI)	P value
IL1RN^*1	96.2	92.3	1.00	0.064
IL1RN^*2	3.8	7.5	2.03 (1.01–4.08)
IL1RN^*3	0	0	—
IL1RN^*4	0	0.2	0.60 (0.56–0.64)
IL1RN^*5	0	0	—
TNF1	89.0	92.8	1.00	0.076
TNF2	11.0	7.2	0.63 (0.39–1.02)

Data for allele frequency are expressed as percentages.

Table 4. Association of Disease with Carriage of IL1RN^*2 and Noncarriage of TNF2.

	Control		Patient		Odds ratio (95% CI)
	N	%	N	%
IL1RN^*2 − /TNF2 +	25	17.2	37	12.5	1.00
IL1RN^*2 − /TNF2 − or IL1RN^*2 + /TNF2 +	113	77.9	224	75.4	1.36 (0.75–2.47)
IL1RN^*2 + /TNF2 −	7	4.8	36	12.1	3.57 (1.32–9.64)a

^ap = 0.0468 when compared with normal controls.

Discussion

A great body of evidence has shown that cytokines and growth factors play an important role in the pathogenesis of chronic kidney diseases.[2] IL-1 and TNF-α are frequently expressed in the glomeruli of various chronic glomerulonephritides.[12-14] IL-1ra, witha homology in amino acid sequence of 19% and 26% with IL-1α and IL-1β, respectively, inhibits IL-1 via competition for receptor binding and is a powerful anti-inflammatory agent in the human body. The variability of cytokine production, which can be derived from genetic polymorphism, may affect its biological activity. The impact of cytokine gene polymorphism on chronic kidney diseases has been studied in recent years. In particular, the IL-1ra and TNF-α gene polymorphisms have been correlated with IgA nephropathy,[6] diabetes mellitus,[5] and systemic lupus erythematosus.[4] Because IL-1 and TNF-α are nonspecific proinflammatory cytokines that can be involved in various renal diseases, we hypothesized that patients with ESRD may be associated with some poor prognostic genotypes.

In this study, we found a trend toward an increased allele frequency of IL1RN^*2 in the patients when compared with normal controls, although not statistically significant (7.5% versus 3.8%, p = 0.064) (Table 3). Previously, we demonstrated a significant correlation between this allele and the susceptibility of IgA nephropathy.[6] When examining the etiologies of our patients in the present study, a disproportionately higher percentage was found in the “chronic glomerulonephritis” category as compared to “diabetes mellitus.” Because IgA nephropathy is the most common diagnosis of primary glomerular disease in Taiwan, a selection bias may have been created by enrolling more patients with IgA nephropathy with end-stage renal failure. On the other hand, less patients with diabetes were enrolled. This however, would not significantly affect the result, because a correlation between carriage of IL1RN^*2 and diabetic nephropathy has been reported before.[5] With the inclusion of more diabetic patients, a more significant p value might be obtained. Taken together, we would like to propose that a role of IL1RN^*2 in the pathogenesis of end-stage renal failure cannot be ignored. A similar finding was obtained by Freedman et al.[15] Using genetic linkage analysis, they were able to find an association between IL1RN^*2 and end-stage renal disease, irrespective of underlying etiologies, among African Americans.[15] We postulated that IL1RN^*2 represents a nonspecific disease marker or the so-called “renal failure gene” that codes for a poor prognosis no matter what the original renal disease. The presence of a “renal failure gene” was shown in an animal model.[16] Indeed, we[6] and others[17] have demonstrated an inferior long-term survival rate in IgA nephropathy patients carrying this allele. Other studies also found an association between this allele and poor disease outcome in systemic lupus erythematosus[4] and diabetes mellitus.[5] The mechanism underlying this association is not yet understood. Study of IL-1ra production in individuals carrying IL1RN^*2 has shown an increased rather than decreased synthesis.[18] The production of IL-1ra was not only controlled by the IL-1ra gene but also by the IL-1 gene.[19] On the other hand, the presence of IL1RN^*2 allele is associated with enhanced IL-1 production in vitro.[20] Taken together, it is possible that the carriage of IL1RN^*2 may be associated with an unbalanced IL-1/IL-1ra production, i.e., excessive IL-1 production triggers a nonspecific inflammatory response in various chronic kidney diseases.

An unexpected finding was the trend toward an increased frequency of noncarriage of TNF2 in the patient group (Table 3). When IL1RN^*2 and TNF2 alleles were considered together, the patient group had a statistically significant higher proportion of IL1RN^*2 + /TNF2 − combination (Table 4). It is interesting to find that in a recent report from Syrjanen et al., it was also shown that the noncarriage of TNF2 is associated with an increased susceptibility to IgA nephropathy.[17] Our previous study on IgA nephropathy also demonstrated a decreased TNF2 allele frequency in the patient group, although the difference was not statistically significant.[6] Although most studies have shown higher disease susceptibility in the high-producer (TNF2) genotype, contradictory results have been reported.[21&22] The gene encoded for TNF-α is located within the MHC region. Some of the TNF-α polymorphisms form extended haplotypes with the HLA alleles, of which, numerous disease associations have been discovered. It is not known if TNF2 allele is in linkage disequilibrium with a nearby locus, which is a real disease-associated gene.

In conclusion, we demonstrated that carriage of IL1RN^*2 of the IL-1ra gene and noncarriage of TNF2 of the TNF-α gene might imply a poor prognosis in various chronic renal diseases. Because ethnicity affects genetic polymorphisms and the pattern of ESRD varies among different countries, our conclusion remains to be tested in future studies with a larger population and different ethnicities.

Acknowledgment

This study was supported by a grant (TCVGH-903604C) from Taichung Veterans General Hospital.