shRNA-Mediated BAALC knockdown affects proliferation and apoptosis in human acute myeloid leukemia cells

Abstract

Brain and acute leukemia, cytoplasmic (BAALC) is a novel molecular marker indicating an inferior outcome in acute myeloid leukemia (AML) with normal cytogenetics. The biological function of BAALC is largely unknown. In this study, BAALC gene expression in an acute myeloid leukemia cell line KG1a was knocked down by a small hairpin RNA (shRNA). The expression of BAALC mRNA and protein in the knockdown cells was significantly inhibited. The proliferation and apoptosis status in the knockdown cells were investigated. The growth curves and FACS analysis demonstrated that BAALC gene knockdown resulted in decreased proliferation and enhanced apoptosis in KG1a cells. These results indicated that BAALC may act as an adverse prognostic factor through prompting proliferation and inhibiting apoptosis in leukemia cells.

Keywords:

• BAALC
• ShRNA
• Proliferation
• Apoptosis
• AML

Introduction

Acute myeloid leukemia (AML) is a heterogeneous diseases characterized by a block in differentiation of hematopoiesis, resulting in growth of a clonal population of neoplastic cells or blasts.1,2 The clinical outcomes of AML are very unpredictable, from survival of a few days to complete cure.3,4 The cytogenetic aberrations have recently been identified as important prognostic factors. The cytogenetic risk systems classify AML patients into three groups, i.e. favourable, intermediate and adverse.5,6 AML patients with normal cytogenetics, who are classified in the intermediate prognostic category, constitute the largest cytogenetic subset of AML, approximately 45%. Only 20–42% of karyotypically normal patients are long-term survivors.7^–9 Therefore, identifying prognostic markers that can more precisely predict patient outcome is vital for development of molecular risk-adapted treatment strategies that may improve the clinical outcome of AML.

The influence of altered gene expression on transcription factor activity and signal transduction pathways has demonstrated a critical role in leukemogenesis. The characterization of these genes and their underlying pathways could potentially aid distinguishing prognostically different subsets of AML patients, especially those with normal karyotype and may lead to development of new targeted therapies.10^–12

Human brain and acute leukemia, cytoplasmic (BAALC) gene, located on human chromosome 8q22·3 and encoding a protein with no homology to known proteins or functional domains was identified.13,14 The expression of BAALC was clearly related to inferior outcomes and may be an important risk factor in AML with normal cytogenetics.15^–17 In comparison to low BAALC-expressing patients, the high BAALC-expressing patients have a higher rate of primary resistant leukemia as well as a higher cumulative incidence of relapse, resulting in significantly inferior overall survival.18 Multivariable analysis identified BAALC expression as an independent prognostic factor. Although the prognostic value of BAALC-expression has been shown in cytogenetically normal acute myeloid leukemia (CN-AML), the function of BAALC remains largely unknown. Functional studies investigating the impact of BAALC expression in leukemia cell lines could not demonstrate a mechanistic role of BAALC on proliferation and apoptosis.

In the current study, we investigated the effect of short hairpin RNA (shRNA)-mediated BAALC gene knockdown on proliferation and apoptosis in KG1a cells. Results showed that BAALC gene knockdown can inhibit proliferation and induce apoptosis in KG1a cells. Our results indicate that specifically targeting BAALC may improve the therapeutic outcome of AML.

Materials and methods

Materials

Bbs I, BamH I, Pst I restriction enzymes (NEB, USA), T4 DNA ligase, reverse transcriptase (RT) kit (Takara Co. Ltd, Shenyang, China), polymerase chain reaction (PCR) master mix (Toyobo, Japan), pGPU6/GFP/Neo siRNA plasmid vector (Genepharma Biotec, Shanghai, China), Nucleofector system (Lonza, Germany), fetal bovine serum (Gibco, USA), plasmid extraction kit (Promega, Madison, USA), RPMI-1640, G418 (Sigma, USA), Trizol (Invitrogen Biotec, Shanghai, China), ECL kit (Keygen Biotec, Nanjing, China), Cell Counting Kit-8 (CCK-8) assay kit (Beyotime Biotec, Jiangsu, China), 12-O-tetradecanoyl-phorbol-13-acetate (Sigma, USA) and nitroblue tetrazolium (NBT; Sigma, USA), Annexin V-FITC and Tunel apoptosis detection kit (Keygen Biotec, Nanjing, China).

Cell lines and culture

Human acute myeloid leukemia cell line KG1a, purchased from the German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany), were cultured in RPMI-1640 supplemented with 10% FBS and 2 mM l-glutamine in a humidified atmosphere with 5% CO₂ at 37°C.

Generation of BAALC short hairpin RNA expression plasmids

Basic Local Alignment Search Tool (BLAST 2) homology searching was used to identify conserved cDNA fragments for RNA interference (RNAi) within the coding region of the BAALC gene. Four 19-nt siRNAs targeting different nucleotide sites of BAALC mRNA were designed, and four pairs of 57-nt oligonucleotides coding shRNAs containing 19-nt reverted repeat, 9-nt spacer sequence, Bbs I and BamH I restriction enzyme sites were synthesized. Oligonucleotides were annealed and inserted into the shRNA expression vector pGPU6/GFP/Neo to form pGPU6/GFP/Neo-BAALC-shRNA1-4. pGPU6/GFP/Neo-shRNA-NC (Shanghai GenePharma Co., Shanghai, China) containing a scrambled sequence with no significant similarity to mouse, rat, or human gene sequences was used as a negative control vector. The ‘housekeeping’ gene glyceraldehyde phosphodehydrogenase (GAPDH) was used as positive control and pGPU6/GFP/Neo-shRNA-GAPDH was also constructed. Oligonucleotide sequences are shown in Table 1.

Table 1. Oligonucleotide sequences of shRNAs

Name	Sequences
ShRNA-BAALC-1	5′-CACCGCTAACTCTGTTATTCTTCATTCAAGAGATGAAGAATAACAGAGTTAG TTTTTTG-3′, 3′-CGATTGAGACAATAAGAAGTAAGTTCTCTACTTCTTATTGTCTCAATC AAAAAACCTAG-5′
ShRNA-BAALC-2	5′-CACCGAGACTGAATTAGACCCTTTCAAGAGAAGGGTCTAATTCAGTCTCTTTTTTG-3′,3′-CTCTGACTTAATCTGGGAAAGTTCTCTTCCCAGATTAAGTCAGAGAAAAAACCTAG-5′;
ShRNA-BAALC-3	5′-CACCGTCACAAAGAACTGTGTCAATTCAAGAGATTGACACAGTTCTTTGTGATTTTTTG-3′,3′-CAGTGTTTCTTGACACAGTTAAGTTCTCTAACTGTGTCAAGAAACACT AAAAAACCTAG-5′
ShRNA-BAALC-4	5′-CACCGCATGCTGGAAGATGGACTTTCAAGAGAAGTCCATCTTCCAGCATGCTTTTTTG-3′, 3′-CGTACGACCTTCTACCTGAAAGTTCTCTTCAGGTAGAAGGTCGTACG AAAAAACCTAG-5′
ShRNA-GAPDH (positive control)	5′-CACCGTATGACAACAGCCTCAAGTTCAAGAGACTTGAGGCTGTTGTCATACTTTTTTG-3, 3′-CATACTGTTGTCGGAGTTCAAGTTCTCTGAACTCCGACAACAGTATG AAAAAACCTAG-5′
ShRNA-NC (negative control)	5′-CACCGTTCTCCGAACGTGTCACGTTCAAGAGATTACGTGACACGTTCGGAGAATTTTTTG-3′, 3′-CAAGAGGCTTGCACAGTGCAAGTTCTCTAATGCACTGTGCAAGCCTCTT AAAAAACCTA G-5′

Stable transfection of KG1a cells

BAALC short hairpin RNA expression plasmids, pGPU6/GFP/Neo-shRNA-NC and pGPU6/GFP/Neo-shRNA-GAPDH with a neomycin resistance gene were transfected into KG1a cells at a concentration of 40 nM using the Nucleofector system (Lonza kit, Germany) according to the manufacturer’s protocol. Two days after transfection, green fluorescent protein (GFP) expression was observed. For all studies, pooled populations of G418-resistant cells were used to eliminate clone variations. The cells were continuously cultured in G418 (400 µg/mL) containing medium.

Reverse transcriptase polymerase chain reaction

Total RNA was extracted from 2×10⁶ cells using Trizol followed by phenol–chloroform extraction and isopropanol precipitation. Total RNA (1 μg) was incubated at 37°C for 100 minutes, then heated at 87°C for 5 minutes and used as a template for first-strand complementary DNA (cDNA) synthesis, using a RT kit. GAPDH was used as an internal standard yielding a polymerase chain reaction (PCR) product of 224 bp. The primers and probes were used as follows: BAALC, forward(F) 5′-CCATCGAGCCCCGCTACT-3′, reverse(R) 5′-TGTAGGTGAGCCAGGTGGATT-3′, yielded a PCR product of 67 bp; GAPDH, F 5′-GAAGGTGAAGGTCGGAGTC-3′, R 5′-GAAGATGGTGATGGGATTTC-3′. Standard RT–PCR was performed on an MJ 9700 (Applied Biosystems). The PCR protocol consisted of 35 cycles of 94°C for 30 seconds, 56°C for 45 seconds, and 72°C for 1 minute. In all experiments, two negative controls were carried through all steps. The PCR amplification products were separated in 1% agarose and visualized by ethidium bromide (EB) staining.

Western blot analysis

The cytoplasmic protein (50 μg/lane) from each sample was resolved in 10% SDS–polyacrylamide gel electrophoresis (PAGE), transferred to a PVDF membrane (Millipore, UK) and blotted with the various antibodies. Non-specific binding was avoided by blocking the nitrocellulose membrane with 5% skimmed milk in TBS-T for 1 hour. The 5% skimmed milk in TBS-T was also used to dilute primary (BAALC, mouse monoclonal antibody, 1∶100, CST) and HRP-conjugated monoclonal secondary (1∶5000; Amersham Pharmacia Biotech, NJ, USA) antibodies. The membranes were incubated with the primary antibodies overnight at 4°C and in the secondary antibody for 1 hour at room temperature. The quantity of protein loaded was verified by staining the same membranes with anti-beta actin antibody (1∶2000, Sigma-Aldrich, Dorset, UK). The signals were detected on X-ray films using an ECL Western blotting detection kit (Amersham, Pharmacia Biotech).

Proliferation assay

The CCK-8 assay was performed to assess the effect on cell proliferation. Stably transfected blast cells were plated in 96-well plates at a density of 3·0×10³ cells/well, then for 4 days, every 24 hours a batch of cells were stained with 10 μL sterile CCK-8 dye (3 mg/mL) then incubated in medium at 37°C for 2 hours. Spectrometric absorbencies at 450 and 630 nm were measured using a microplate reader. All groups were measured in triplicate. Results were plotted as mean±SD of these separate experiments having six determinations per experiment for each experimental condition.

Statistical analysis

All statistical analysis was conducted with SPSS 13·0 software. Means were compared using an adjusted Student’s t-test. Values were considered significantly different when P<0·05.

Results

Identification of the recombinant plasmid vector

To validate the BAALC-targeting shRNA expression vector, recombinant plasmid DNA was extracted and agarose gel electrophoresis was conducted. A single electrophoretic band smaller than 100 bp by 1% agarose gel electrophoresis indicated the success of Oligo single strand annealing (Fig. 1A). The shRNA expression vectors targeting BAALC were digested by BamH I and Pst I restriction endonuclease, and the successfully constructed plasmid could be digested by BamH I and Pst I (Fig. 1B).

Figure 1. Results of 1% agarose gel electrophoresis. (A) A single electrophoretic band smaller than 100 bp by 1% agarose gel electrophoresis indicated the success of Oligo single strand annealing; (B) shRNA expression vectors targeting BAALC could be digested by BamH I and Pst I.

BAALC shRNA reduced BAALC mRNA and protein expression

The BAALC shRNA-expressing plasmid was constructed using the pGPU6/GFP/Neo vector to target human BAALC gene; shRNA-NC and shRNA-GAPDH plasmids were also constructed to act as a negative and positive control, respectively. To examine the efficacy of plasmids in silencing BAALC mRNA expression, they were stably transfected into leukemia cells. Total RNA was isolated from the transfected cells and the mRNA levels of BAALC and GAPDH were measured using RT–PCR. As shown in Fig. 2A, BAALC mRNA expression was markedly decreased in the pGPU6/GFP/Neo-BAALC-shRNA1-4 transfected cells. Consistently, the GAPDH mRNA levels in KG1a cells were also more poorly transfected with the positive control plasmid of shRNA-GAPDH, whereas no change was observed in the pGPU6/GFP/Neo-shRNA-NC mock transfected cells. The protein levels of the BAALC gene were also analysed. In line with the mRNA expression changes, the levels of BAALC protein were also remarkably inhibited in different pools of cells transfected with BAALC shRNA-expressing plasmid compared with those transfected with shRNA-NC-expressing plasmid.

Figure 2. Effects of BAALC shRNA on mRNA and protein expression. (A) Results of 1% agarose gel electrophoresis showed that BAALC mRNA expression was decreased in cells transfected with pGPU6-BAALC-shRNA1-4. However, no change was observed in cells transfected with pGPU6-shRNA-NC. Lane 1: control; Lane 2: GAPDH-shRNA; Lane 3: GAPHD-shRNA-NC; BAALC: Lane 3: BAALC-shRNA-NC; Lanes 4–7: BAALC-shRNA-1-4. (B) Results of western blot showed that BAALC protein levels were markedly inhibited in pGPU6-BAALC-shRNA1-4 transfected leukaemia cells, in contrast to the negative control plasmid-transfected cells. Lane 1: BAALC-shRNA-NC, Lanes 2–5: BAALC-shRNA-1-4.

Decreased cell proliferation caused by knocking down BAALC

CCK-8 assays were conducted to determine whether silencing of BAALC affected the growth of leukemia cells. As shown in Fig. 3, proliferation of KG1a-BAALC shRNA cells was significantly suppressed at each different time point (48, 72 and 96 hours), compared with the control groups during the time course (P<0·05). These growth curves indicated that BAALC shRNA could inhibit the growth of cells.

Figure 3. Mean ODs were measured by CCK-8 assay, proliferation of KG1a-BAALC shRNA cells was significantly suppressed at each different time point (48, 72 and 96 hours), compared with the control groups during the time course.

BAALC knockdown induced apoptosis in leukemia cells

To explore the effect of BAALC knock down on leukemia cell apoptosis, BAALC shRNA-expressing plasmid was transfected into KG1a cells. First, the apoptotic nuclear changes (i.e. punctuated or granular and bright nuclei) were determined after DAPI staining and visualized by fluorescence microscopy. The apoptotic cellular nuclear changes (Fig. 4A) were observed predominantly in the pGPU6/GFP/Neo-BAALC-shRNAs transfected but not pGPU6/GFP/Neo -shRNA-NC transfected cells. In addition, the proportion of apoptotic cells was also determined by FACS analysis. As shown in Fig. 4B and Table 2, Annexin V-FITC results showed that BAALC shRNA induced apoptosis relative to cells transfected with pGPU6/GFP/Neo-shRNA-NC (12·67% vs 85·33%, P<0·05).

Figure 4. Effects of BAALC shRNA on apoptosis in KG1a cells. (A) KG1a cells were stained with DAPI and observed under fluorescence microscopy (punctuated, granular, and brighter nuclei). (B) Results of Annexin V-FITC (measured by FACS).

Table 2. Apoptosis of KG1a cells after different treatments

N	–VE (%)	shRNA-NC (%)	shRNA-BAALC (%)	F	P
3	3·33±0·58	12·67±3·06*	85·33±3·06*▾	954·596	0·000

Values are expressed as mean ±SD of three independent experiments.* vs. –VE, P<0·05; ▾ vs. shRNA-NC, P<0·05.

Discussion

RNA interference (RNAi) describes a conserved biological response to double-stranded RNA (dsRNA) resulting in the degradation of homologous messenger RNA. In the last few years, this process of sequence-specific, post-transcriptional gene silencing has become a key technique for rapidly assessing gene function in species ranging from plants to mammals. Many reports have shown promising therapeutic potential of small hairpin RNA (shRNA) in modulating gene function.19,20 In order to investigate the effect of BAALC gene on proliferation and apoptosis in acute myeloid leukemia cells, we stably knocked down BAALC expression in a human acute myeloid leukemia cell line KG1a, which highly expresses BAALC gene. Results demonstrated that knockdown of BAALC gene by BAALC shRNA down-regulated both mRNA and protein expression of BAALC in KG1a cells. This result indicates that BAALC shRNA expression plasmids were successfully constructed and transfected into KG1a cells.

BAALC expression was commonly detected in haematopoietic precursors and neuroectoderm-derived tissues. It encodes a protein with no homology to currently known proteins or functional domains.13,14 High expression of BAALC mRNA in circulating blasts was reported in patients with de novo CN-AML and was an indicating factor for failure to achieve complete remission (CR), associated with primary resistant disease and significantly shorter overall survival (OS) as well as a higher cumulative incidence of relapse (CIR).18,21,22 However, there has not been a report describing the function of BAALC in the literature. To investigate the role of BAALC with the apoptosis and proliferation of KG1a cells, we transfected the BAALC shRNA expression vector into KG1a cells, then determined any potential effects on the proliferation and apoptosis of KG1a cells. Knockdown of BAALC expression in KG1a cells resulted in significant inhibition of cell proliferation when compared with the control cells. Enhanced apoptosis was also observed in the BAALC knockdown cells. The results indicate that BAALC expression contributed to the development of KG1a cells by a possible pathway of enhancing cell proliferation, inhibiting apoptosis. Our study provides in vitro evidence supporting the role of BAALC as an oncogene. The results are in accordance with our previous report and other research, showing that high levels of BAALC mRNA are related to higher proliferation of bone marrow blasts leading to higher peripheral white blood cell counts and an inferior clinical outcome.

In conclusion, our results showed that shRNA-mediated silencing of BAALC inhibited proliferation and induced apoptosis of KG1a cells. Targeting BAALC may be a novel and effective approach for leukaemia treatment.

This work was supported by grant no. 2007B030704010 from the Scientific and Technology Program Foundation of Guangdong Province.