C950T and C1181G osteoprotegerin gene polymorphisms in myeloma bone disease

Abstract

Objectives

Bone disease is one of the hallmarks of multiple myeloma (MM). The role of osteoprotegerin (OPG) in the RANK/RANKL/OPG signaling system is well defined in the myeloma bone disease. Polymorphisms of the TNFRSF11B gene encoding OPG have been studied in various bone diseases. However, relationship between the levels of OPG and development of bone lesions regardless of RANKL is yet unknown. In this study, the effects of OPG gene polymorphism on the development of bone lesions in MM were investigated.

Methods

C950T and C1181G polymorphisms of the OPG gene were studied in 52 MM patients (36 with bone lesions and 16 without bone lesions) and in another 20 control subjects using DNA sequencing.

Results

1181 G and 950 T alleles were overrepresented in MM patients having bone lesions. 950 TT/1181 GG haplotype frequency and TT/GG combined haplotype were also higher in MM patients having bone lesions compared to MM patients without bone lesions or to control.

Discussion

This is the first study searching for the relationship between OPG gene variants C950T (promoter), C1181G (exon 1), and myeloma bone disease. It was concluded that the presence of polymorphic 1181 G/950 T alleles and 950 TT/1181 GG genotypes may play a role in the development of bone disease.

Keywords:

• Multiple myeloma
• Osteoprotegerin
• Gene polymorphism

Introduction

Multiple myeloma (MM) is a malignant plasma cell disorder that originated from a single clone of the bone marrow and is characterized by production of monoclonal immunoglobin.¹ Skeletal destructions accompanied by osteolytic lesions, osteopenia and/or pathological fractures are common features MM.² A reason for the skeletal lesions seen in MM is the change in the normal balance between bone formation and resorption.³ Different interaction between myeloma cells and the microenvironment consisting of bone marrow stromal cells, extracellular matrix proteins, vascular endothelial cells, osteoclasts, osteoblasts, and lymphocytes have an impact in the bone destruction.⁴

RANK, RANKL, MIP-1α, IL-3, and IL-6 produced by myeloma cells are important in the bone resorption.⁵ The role of RANK/RANKL/osteoprotegerin (OPG) system is well defined. RANKL is expressed in osteoblasts and contributes the bone resorption via induction of the differentiation and the activation signals by binding its receptor RANK in the osteoclasts.⁶ On the other hand, OPG inhibits the bone deformation induced by osteoclasts.^7,8 OPG has effects exactly opposite to the effect of RANK/RANKL and acts as a decoy receptor for RANKL.⁹

OPG protein is encoded by a gene called tumor necrosis factor receptor superfamily 11b (TNSFR11b) located on the short arm, 24th region of the 8th chromosome. The gene is so-called osteoclastogenesis inhibitor factor and has five exons. OPG protein synthesis may be influenced by Runx2/Cbfal signaling pathway.¹⁰ On the other hand, induction of WNT signaling pathway has been shown to increase expression of OPG in osteoblasts, while reducing the RANKL expression.^11,12 In MM cell lines induced imbalance in OPG/RANKL expression has been found in the bone marrow (BM)-like environment showing that there is reduced production of OPG by MM cells.¹³

In this study, the effects of OPG gene variants C950T; rs2073617 (promoter) and G1181C; 2073618 (exon1) on the development of bone lesions in MM were investigated.

Methods

Study population

Fifty two MM patients, admitted to Karadeniz Technical University, Medical Faculty, Department of Internal Medicine, Division of Hematology between March 2011 and March 2012, were included into the study. Pathologic fracture and/or destructive bone lesions were confirmed in 36 MM patients using X-ray, computed tomography (CT), or magnetic resonance imaging. No bone lesions were noted in 16 patients. The control group consisted of 20 age- and gender-matched volunteers. Institutional Ethical committee approved the study (21.02.2011; 2011/19). The characteristics of patients and the control group are given in Table 1.

Table 1. Characteristics of patients and controls

Genomic DNA isolation and PCR amplification of OPG gene exon 1

Genomic DNAs were isolated using 200 µl peripheral blood samples of subjects using automated workstation according to manufacturer's instruction (QiagenBiorobot EZ1, USA). DNA samples were stored at −20°C. OPG gene exon1 and its flanking 5′ 287bp, 3′ 199bp sites were amplified using primer pair obtained from Primer3 (frodo.wi.mit.edu). Primer pair forward ‘GTTTCAGAACCCGAAGTGAAG’ and reverse ‘AACTTTGCAGCGTAAAAGGAC’ in 5X enzyme buffer solution (PromegaGoTaq Flexi Kit, USA) consisting 5 U/µl Taqpolimerase, 25 mM MgCl₂, 10 mM dNTP (Promega, USA, Lot No: 325473), molecular grade water and 30 ng/µl DNA at following conditions; initial denaturation 94°C 6′, denaturation 94°C 30″, annealing 56°C 1′, elongation 72°C 1′, final elongation 72°C 6′, and final hold +4°C.

Genotyping

PCR products were purified using nucleic acid extraction kit according to the manufacturer's instructions (Vivantis GF-1, Oceanside, CA, USA). Sequence reactions were set up with purified PCR products using Dye Terminator Cycle Sequencing (DTCS) kit (Beckman Coulter, GenomeLab Dye Terminator Cycle Sequencing (DTCS), Foster City, CA, USA). Products were cleaned with Sephadex G50 (Sigma, St Louis, MO, USA) and run on the capiller electrophoresis system (Beckman Coulter, CEQ 8000, Fullerton, CA, USA).

Statistical analysis

Statistical analysis was performed using SPSS software (version 11.0.1, Chicago, IL, USA). Comparison of genotype frequencies were performed by χ² test. P value smaller than 0.05 was accepted to be statistically significant.

Results

Exon 1 of OPG gene was sequenced using DNA samples obtained from peripheral blood samples of 52 MM patients and 20 healthy control subjects. OPG gene C950T and C1181G polymorphisms were identified in 45 (33 with bone lesions) MM patients and in 16 control subjects. Polymorphic allele 1181G was higher in MM patients with bone lesions compared to MM patients without bone lesions and control group (χ² = 8.629, P = 0.013). Other polymorphic allele 950T was also overrepresented (73%; P = 0.042) in MM patients with bone lesions compared to MM patients without bone lesions and the control group (Tables 2 and 3). Genotype frequencies are given in Table 4. The most frequent genotype observed in patients with myeloma bone lesions was 950 TT homozygous variant (56%, P = 0.08) followed by 1181 CC homozygous wild type with 50% frequency (P = 0.09). The frequency of 950 CT heterozygous genotype was higher in MM patients without bone lesions (50%, P = 0.604). 1181 GG genotype showed higher frequency in MM patients with bone lesions compared to patients without bone lesions and control group (χ² = 3.853, P = 0.145).

Table 2. OPG gene polymorphisms in MM patients with bone lesions, without bone lesions and controls

Table 3. Allele frequencies

Table 4. Frequencies of genotypes

Of the combined haplotypes, 950 TT/1181 GG haplotype frequency is higher in patients with myeloma bone lesions (36%) compared to MM patients without bone lesions (13%) and controls (15%) (χ² = 4.77, P = 0.09). The frequency of TT/GG combined haplotype carriers in bone disease patients is higher than of those who do not have either polymorphic homozygous alleles (CT/CC and CC/CC haplotypes) (χ² = 6.057, P = 0.048). Additionally, 950 CC/1181CC wild-type haplotype frequency was reasonably low in patients with myeloma bone lesions (8.3%, P = 0.240).

Discussion

RANK/RANKL/OPG system has a pivotal role in osteoclast differentiation and activation. In various bone tumor cells, this system is active for bone resorption.^14,15 Mutations in the OPG gene have been shown in patients with autosomal recessive idiopathic hyperphoshotasia and juvenile Paget's disease. Furthermore, the function of aspartate 182 deletion of the OPG gene has been identified.^16–18 It was shown that OPG_D182 inhibits the generation of osteoclasts less effectively than the wild-type protein and has reduced ability of binding to RANKL, thus impairs both the secretion and activity of OPG. Further studies on mice conducted to analyze OPG gene function showed that OPG knockout mice developed advance osteoporosis, had bone lesions and fractures especially in long bones and vertebras,¹⁹ providing information for the increased bone turnover and osteoclastogenesis.

Variants of the OPG gene and their relation to bone defects highly observed in cancers and hereditary disorders. A163G (promoter), C950T (promoter), and G1181C (exon1) polymorphisms of the OPG gene have been previously detected in different disorders in various populations.²⁰ In a Belgian study population with Paget's Disease, polymorphic 950T and 1181G alleles were found at a high level in female population suggesting these polymorphisms could be sex-specific associated with this bone disease.²¹

Homozygous 950TT genotype and 1181 G polymorphic allele were found associated to osteoporotic fractures in postmenapausal women, as bone mineral densities (BMDs) of patients seemed to be influenced by these polymorphisms.²² However, C950T variation in the promoter was not found to be associated with osteoporosis.²³ 1181 C allele was found to be associated with lower lumbal spine BMD in men aged 40–79 years from eight European populations.²⁴ The other study was detected that OPG gene polymorphisms influence BMD in postmenopausal women, independently serum OPG concentration.²⁵ Studies showed that serum and bone marrow levels of OPG are reduced in MM patients with bone lesions suggesting that there is an impaired function of OPG in myeloma.²⁶

In this study, the association between OPG gene polymorphisms C950T and C1181G and bone defects of MM patients were investigated. We found that polymorphic 950 T and 1181G alleles were overrepresented in patients with myeloma bone disease, which suggest that these variants might be associated with bone disease. Additionally, presence of both 950 TT and 1181 GG genotypes was thought to be probable predisposing factors in myeloma bone disease.

In the IMR-90 human embryonic lung fibroblast cells, the G allele was found same frequency with C allele in the C1181G polymorphism of OPG gene.²⁷ The polymorphism codes for a lysine/aspargine amino acid substitution at the third codon of first exon, results a non-conservative amino acid change. However, the effect of this change on the gene function remains unclear and is needed to be studied.

Conclusion

We conclude that the presence of polymorphic 1181 G/950 T alleles and 950 TT/1181 GG genotypes may play a role in the development of bone disease due to the reduced function of OPG and the activated RANKL-RANK pathway.

Authorships and disclosures

M.S. designed the project; N.K. collected patient samples; B.Y. and N.K. did the experiments; M.T. and F.U. did the statistical analysis; B.Y. and N.K. wrote the paper with the input from M.S. and F.U.; M.S. edited the manuscript.