Induction of apoptotic change in the rat hippocampus caused by ferric nitrilotriacetate

Abstract

Iron, a source of oxidative stress, plays a major role in the pathology of neurodegenerative disease. In Alzheimer's disease, the hippocampus is vulnerable to oxidative stress, leading to impairment in memory formation. In our previous study, a brain oxidative reaction was induced after intraperitoneal injection of ferric nitrilotriacetate (Fe-NTA). However, since only a small amount of iron reached the brain in the previous study, Fe-NTA was administered into the hippocampus using an osmotic pump in this study.

After continuous injection of Fe-NTA for 2 weeks, a high level of apoptotic change was induced in the hippocampus, in accordance with the iron localization. After injection for 4 weeks, the hippocampus was totally destroyed. A small amount of iron infiltrated into the cerebral cortex and the striatum, and deposition was observed at the choroid plexus and ependymal cells. However, no apoptotic reaction or clear tissue injury was observed in these areas. In addition, muscarinic acetylcholine receptors (M1, M2, and M4) were decreased in both the cortex and hippocampus while it increased in the striatum. Thus, the hippocampus is likely vulnerable to oxidative stress from Fe-NTA, and the oxidative stress is considered to bring the disturbance in the muscarinic acetylcholine receptors.

Keywords:

• Iron
• Ferric oxidative stress
• Hippocampus
• Acetylcholine receptor

Introduction

In the pathology of neurodegenerative diseases such as Alzheimer's disease (AD) and Parkinson's disease, oxidative stress plays a major role. Plausible sources of oxidative stress in the AD brain include beta-amyloid deposition, activated microglia, senescent mitochondria, and neural sequestration of redox-active iron above levels encountered in the course of normal aging.¹ Although iron is essential in the brain, excessive free iron generates oxidative stress, leading to neuronal diseases linked to aging.² In addition, recent studies revealed that a disturbance in brain iron homeostasis and dysfunction in catalase for scavenging hydrogen peroxide (H₂O₂) contribute to the pathogenesis of neurodegenerative diseases,^3,4 suggesting that iron metabolism and a balance of redox reactions regarding iron may be pivotal in inducing oxidative stress in the brain.

Clinical symptoms of AD in the early stage are mild cognitive dysfunction and memory deficits, indicating that hippocampal synaptic transmission and plasticity are impaired because the hippocampus is indispensable for memory formation.⁵ Using transgenic animals relevant to AD, numerous plaques in the hippocampus have been observed,^6,7 and excitatory synaptic transmission in the hippocampus was impaired,⁸ leading to the conclusion that the hippocampus may be vulnerable to oxidative stress linked to pathological changes in AD.

Ferric nitrilotriacetate (Fe-NTA) is an iron chelate that can induce strong oxidative stress via its unique characteristics.⁹ The oxidative stress caused by intermittent injection of Fe-NTA causes diabetes as well as kidney carcinoma.^10,11 Recently, we demonstrated that brain oxidative changes were induced after intraperitoneal (i.p.) injection of Fe-NTA in rats.¹² In that study, the level of heme oxygenase (HO)-1 mRNA was raised, and lipid peroxidation was exaggerated, as well as changes in muscarinic acetylcholine receptors (mAChRs) in the brain. However, since iron accumulating in the brain was sparse, the effects of Fe-NTA in the brain are considered much weaker compared to those in peripheral organs such as the liver and kidneys after peripheral injection of Fe-NTA. In this study, a low dose and small amount of Fe-NTA was injected directly into the hippocampus for several weeks using an osmotic pump, and the direct effect of Fe-NTA on the hippocampus was observed. In addition, we evaluated the changes of mAChRs, which were affected by i.p. injection of Fe-NTA in our previous report.

Methods

Animal treatment

Male DDY mice were obtained from Shimizu Laboratory Supplies (Kyoto, Japan) at 8 weeks of age. The animals were housed in groups at 25°C with food and water available ad libitum. All experimental procedures were approved by the Okayama University Animal Care Committee.

Fe-NTA solution was prepared by the method of Awai et al.¹¹ Osmotic minipumps (Model 2004, Alzet, Cupertino, CA, USA), which deliver their contents at a rate of 0.25 µl/hour for up to 4 weeks, were each connected by a polyethylene catheter to a stainless-steel cannula (Brain Infusion Kit 3, Alzet) and loaded Fe-NTA solution (Fe 0.1 mg/ml) for 2 or 4 weeks. The concentration of Fe-NTA solution was determined from a preliminary experiment, in which we compared Fe concentrations of 1, 0.5, or 0.1 mg/ml, resulting in a survival rate of more than 80% in groups administered Fe 0.1 mg/ml of Fe-NTA solution, which was selected. The concentration was 10 times lower than that used for ip injection, and the total amount of Fe was 16.8 µg over 4 weeks.

Mice were anesthetized by ip injection of pentobarbital (50 mg/kg), and their skulls were carefully exposed. The Brain Infusion Kit was stereotaxically implanted into the right hippocampus. The stereotaxic coordinate used was 1.5 mm posterior to the bregma, 1.5 mm lateral to the midline, and 2.0 mm from the surface of the skull, using a flat skull position.¹³ The kit was attached to the skull with dental cement and connected to the osmotic minipump, which was filled with normal saline solution (NSS) or Fe-NTA solution, prepared as described above. The pump was implanted under the skin of the mouse's back, and an antibiotic (ampicilline 50 mg/kg, Sigma, St Louis, MO, USA) was injected subcutaneously.

In order to compare the oxidative injury caused by Fe-NTA with other free radical inducers, we used H₂O₂ because it has been widely used as a reactive oxygen species. We administered 0.01% of H₂O₂ for 2 weeks in the same manner as Fe-NTA injection.

HE staining

After 2 or 4 weeks of injection, the mice were anesthetized again and perfused with NSS and 4% of paraformaldehyde in phosphate buffer, pH 7.6. The brains were removed and postfixed overnight in a fixative. After fixation, the brains were embedded in paraffin and cut into 8 µm sections, which were adhered to poly-l-lysine-coated slides by heating them at 60°C for 15–20 minutes. After deparaffinization and rehydration, the tissue was stained with HE solution.

Iron histochemistry

The brain sections were deparaffinized and immersed in a potassium ferrocyanide mixture (Perl's solution containing 1 part of 10% aqueous, potassium ferrocyanide and a half part of 10% hydrochloric acid), and rinsed. The stain was emphasized by incubation for 20 minutes in 0.5% of diaminobenzidine (DAB) in 0.1 M phosphate-buffered saline (PBS) and 15 minutes in the same medium including 0.005% of H₂O₂, followed by rinsing in water. After that, sections were counterstained with toluisine blue.

TUNEL staining

Apoptotic cells were stained using a MEBSTAIN Apoptosis Kit II (MBL, Nagoya, Japan). After deparaffinization, sections were rinsed with PBS, followed by a treatment with proteinase K for 30 minutes at 37°C. After washing, they were incubated with TdT solution containing TdT and biotin-conjugated dUTP for 60 minutes at 37°C, and then with TB buffer for 15 minutes at room temperature. They were washed again, treated with blocking solution, incubated with avidin-fluorescein isothiocyanate solution for 30 minutes at 37°C, followed by washing with PBS.

Realtime reverse transcriptase polymerase chain reaction and dot blot analysis

Twelve mice were used for reverse transcriptase polymerase chain reaction (RT-PCR), and eight out of them were used for dot blot analysis. Half of them were used for injection of Fe-NTA solution as described above, and rest of them were for NSS. After administration for 2 weeks, each mouse was perfused with NSS, and the brains were removed. The contralateral cortex, hippocampus and striatum were removed and immersed in RNA later (Qiagen, Hilden, Germany) for RT-PCR, and the ipsilateral hippocampus was removed and frozen in liquid nitrate for dot blot analysis.¹⁴

Using samples for RT-PCR, total RNA was extracted with phenol. Elimination of genomic DNA and reverse transcription were performed with QuantiTect (Qiagen, Hilden, Germany). Primers used for the amplification of cDNA were summarized in Table 1. Quantitative real-time PCR for M1, M2, and M4 muscarinic receptors was performed using Miniopticon (Bio-rad, Hercules, CA, USA) and SYBR Premix Taq II (Takara, Tokyo, Japan). The reactions were incubated at 95°C for 3 minutes, followed by a cycling protocol consisting of two stages: 10 seconds at 95°C and 30 seconds at 60°C. After 40 cycles of PCR, melting curve analysis was routinely performed. The target cDNA copy number was normalized to that of beta-actin amplified from the same cDNA sample.

Table 1. Mouse gene-specific PCR primers

cDNA (Accession No.)	Sequence (5’–3’)	Location in cDNA
mAChR1	F: GCCTACAGCTGGAAAGAAG	1335–1353
(NM_007698)	R: TGTGCCTCAGGATCTACCAT	1459–1440
mAChR2	F: CCGAGTCTAGTGCAAGGAAG	737–756
(NM_007699)	R: ACGCAGTTTTCAGTCCCAC	864–846
mAChR4	F: TGTTCACAAGCATCGACC	859–876
(NM_203491)	R: GGTGGAGGTTTCTTAATGC	960–942
Beta-actin	F: GACCTCTATGCCAACACAGT	954–973
(NM_007393)	R: AGTACTFGTGCTCAGGAGGA	1092–1073

The cell lysates (2 µg), obtained from the samples for dot blot, were blotted onto a membrane. The membrane was incubated with a mouse anti-4-HNE monoclonal antibody (1:2000; GE Healthcare, Piscataway, NJ, USA) for 1 hour at room temperature. The membrane was treated with chemiluminescent reagents (GE Healthcare), and the signals were detected using x-ray film. After washing the membrane with immunopure IgG elution buffer (Pierce, Rockford, IL, USA), beta-actin monoclonal antibody (1:2000, clone AC-74; Sigma), the secondary antibody, and the detection agents described above were administered. Dot densities were quantified with NIH image software and the expression level of 4-HNE was normalized with that of beta-actin. Data were analyzed by Mann–Whitney test. Significance was taken as P < 0.05.

Results

Tissue staining after injection for 2 weeks

HE staining

After continuous injection of Fe-NTA for 2 weeks, the hippocampus was surrounded with inflammatory cells, and severe atrophy of the hippocampus was observed on the ipsilateral side of Fe-NTA injection (Fig. 1A). In the contralateral hippocampus, there was no significant change (Fig. 1B).

Figure 1. Photomicrographs of HE (A, B), Peal's (C, D), and TUNEL staining (E) after continuous injection of Fe-NTA for 2 weeks. Note that robust inflammation was induced in and around the hippocampus. An apoptotic change was induced in the hippocampus, but not in the vicinity. (Original magnification ×40.)

Perl staining

Deposition of high-level iron was observed mainly on the hippocampal tissue. The iron deposition reached the corpus callosum, the cerebral cortex, and a part of the fimbria of hippocampus. Although iron infiltrated into the cortex and the fimbria, it did not go over the corpus callosum (Fig. 1C). In the contralateral hippocampus, no deposition of iron was observed (Fig. 1D).

TUNEL staining

Positive cells were observed, mainly corresponding to iron localization in the hippocampus. Although iron was observed on part the cerebral cortex and the fimbria of the hippocampus, there were no cells positive for apoptotic changes (Fig. 1E).

Tissue staining after injection for 4 weeks

HE staining

The hippocampal structure was totally destroyed, and it was replaced with a mass of inflammatory cells. However, there were far fewer structural changes in the vicinity of the hippocampal area, such as the striatum, corpus callosum, and cerebral cortex (Figs. 2A and B).

Figure 2. Photomicrographs of HE (A, B, C), Peal's (D, E, F), and TUNEL staining (G, H) after continuous injection of Fe-NTA for 4 weeks. The hippocampus was totally destroyed and replaced by inflammatory cells (A, B). High-level iron accumulated at a marginal area of the hippocampal space, and lower level iron was observed on the choroid plexus and ependymal cells of the third ventricle (D, E). Localization of TUNEL-positive cells corresponded to that of a higher level of iron in the hippocampal space (G, H). (Original magnification ×40 for B, C, E, F, H, and ×100 for A, D, G.)

Perl staining

Although iron deposited at a marginal area of the hippocampal space, the iron did not injure the striatum or the cortex. Also, iron deposition was observed on the both choroid plexus and ependymal cells of the third ventricle, and morphological changes were limited in and around both areas. Although iron filtrated into the cerebral cortex, it did not invade into the brain parenchyma (Figs. 2D and E).

TUNEL staining

Positive signals were observed corresponding to iron distribution at a marginal area of the hippocampal space. However, in other neighboring areas, such as the cortex, striatum, corpus callosum, choroid plexus, and ependymal cells, no cells positive for apoptosis were observed (Figs. 2G and H).

In the contralateral hippocampus, there was no significant change (Figs. 2C and F).

Dot blot analysis

After continuous injection of Fe-NTA for 2 weeks, the level of 4-HNE in the hippocampus was significantly higher than that after NSS injection (Fig. 3).

Figure 3. Dot blot analysis of the hippocampus after continuous injection of Fe-NTA for 2 weeks. The levels of 4-HNE were normalized with beta-actin. Fe-NTA raised the levels of 4-HNE significantly (n = 4, *P < 0.05).

Changes after continuous injection of H₂O₂

H₂O₂, injected at the same point as Fe-NTA, induced apoptotic changes in cells in the striatum as well as the hippocampus, while the damage in the hippocampus was much less than that after Fe-NTA injection (Figs. 4A–C). Fig. 4D is a high magnification picture of white rectangular area of Fig. 4C. The concentration of the TUNEL-positive cells in the striatum was at almost the same level as that in the hippocampus after injection of H₂O₂ (Fig. 4D).

Figure 4. Photomicrographs of HE (A, B) and TUNEL staining (C, D) after continuous injection of H₂O₂ for 2 weeks. (D) is a high magnification picture of white rectangular area of Fig. (C). H₂O₂ induced apoptotic changes in cells in the striatum as well as the hippocampus, while the damage in the hippocampus was much less than that after Fe-NTA injection. (Original magnification; ×40 for A, B, C, and ×100 for D.)

Real-time RT-PCR

In both the cortex and hippocampus, levels of all three kinds of mAChRs were decreased after the Fe-NTA injection significantly (Figs. 5A–F). Especially, M1 mAChR was deteriorated with the Fe-NTA, of which the average level was 17.7 % of NSS group (Fig. 5D). On the contrary, each average of three kinds of mAChRs increased in the striatum (Figs. 5G–I), and there were significant differences in M1 and M4 (Figs. 5G and I).

Figure 5. Changes in levels of M1, M2, and M4 mAChRs in the cortex, hippocampus, and striatum. In both the cortex and hippocampus, levels of all three kinds of mAChRs were decreased after the Fe-NTA injection significantly (Figs 5A–F). Especially, M1 mAChR was deteriorated with the Fe-NTA, of which the average level was 17.7% of NSS group (Fig. 5D). On the contrary, each average of three kinds of mAChRs increased in the striatum (Figs 5G–I), and there were significant differences in M1 and M4 (Figs 5G, I).

Discussion

In this study, the hippocampus was totally destroyed with continuous injection of Fe-NTA for up to 4 weeks, and a large quantity of iron deposition was observed in the hippocampal area. Overall, distribution of ferric iron corresponded to localization of TUNEL-positive cells on the hippocampal tissue. The level of 4-HNE in the hippocampus was raised, indicating that an oxidative change was induced in the hippocampus. Oxidative stress from iron is known to induce a neuronal loss and an apoptotic changes in the hippocampus.^15,16 In our previous report, the iron deposition was sparse, and the apoptotic change was not observed although oxidative change was induced.¹² Therefore, it is considered that oxidative mechanisms causing apoptosis were evoked by the iron from Fe-NTA injected into the brain in our study.

Previously, we reported changes in brain mAChRs after ip injection of Fe-NTA.¹² In this experiment, the changes appeared clearly by the direct injection of Fe-NTA into the brain. Surprisingly, the reaction of the mAChRs of the striatum was contrary to those of both the cortex and hippocampus. Before the experiment, it was speculated that all kinds of mAChRs were deteriorated with oxidative stress, such as a decrease in muscarinic recptor binding in elderly people.¹⁷ In addition, mAChRs in both the cortex and hippocampus are known to have an important role in brain function.¹⁸ However, its role in the striatum is unclear. The increase in the striatum mAChRs may be compensatory reaction to the disturbance in other parts of the brains such as the cortex and hippocampus. In any case, further experiments are necessary to clarify this mechanism.

In AD, significant neuronal loss is observed in the hippocampal CA1 region.¹⁹ In older mice, significant oxidative changes were induced in the CA1 region,²⁰ suggesting that pathological changes in the hippocampus are involved in neurodegenerative diseases. In other oxidative conditions, selective vulnerability has been reported in the hippocampus,²¹ and in the CA1 region.²² In our study, although the regional selective vulnerability to the oxidative stress from H₂O₂ was not observed, the hippocampus may be markedly vulnerable to oxidative stress from Fe-NTA. This result is in accordance with the previous study, in which iron accumulation was shown to be an important contributor toward the oxidative damage of AD.^23,24