Abstract
Growing evidence demonstrates that long noncoding RNAs (lncRNAs) are involved in the progression of various cancers, including hepatocellular carcinoma (HCC). The role of nuclear-enriched abundant transcript 1 (NEAT1), an essential lncRNA for the formation of nuclear body paraspeckles, has not been fully explored in HCC. We aimed to determine the expression, roles and functional mechanisms of NEAT1 in the proliferation and invasion of HCC. Based on real-time polymerase chain reaction data, we suggest that NEAT1 is upregulated in HCC tissues compared with noncancerous liver tissues. The knockdown of NEAT1 altered global gene expression patterns and reduced HCC cell proliferation, invasion and migration. RNA immunoprecipitation and RNA pull-down assays confirmed that U2AF65 binds to NEAT1. Furthermore, the study indicated that NEAT1 regulated hnRNP A2 expression and that this regulation may be associated with the NEAT1–U2AF65 protein complex. Thus, the NEAT1-hnRNP A2 regulation mechanism promotes HCC pathogenesis and may provide a potential target for the prognosis and treatment of HCC.
Introduction
Long noncoding RNAs (lncRNAs) are a new class of noncoding RNAs that are longer than 200 nucleotides. These RNAs have been found to be frequently dysregulated in various diseases and play an essential role in imprinting control, cell differentiation, immune responses, human diseases, tumorigenesis and other biologic processes.Citation1–Citation3 Understanding the lncRNAs that function in various diseases and their precise molecular mechanisms will be critical for exploring potential strategies for early diagnosis and therapy.Citation4 Recent studies have indicated that lncRNA–protein complexes can give rise to unique transcriptional programs, which result in different functions based on the interactions between the bound protein and RNA.Citation5–Citation7 Genetic studies have proven that a significant number of lncRNAs are associated with hepatocellular carcinoma (HCC) and that the interaction between lncRNAs and RNA-binding proteins is involved in HCC tumorigenicity.Citation8,Citation9
The lncRNA nuclear-enriched abundant transcript 1 (lncRNA-NEAT1) is transcribed from the familial tumor syndrome multiple endocrine neoplasia type 1 locus on chromosome 11 and lacks any introns.Citation10,Citation11 NEAT1 is retained in the nucleus, where it forms the core structural component of paraspeckle suborganelles and acts as a transcriptional regulator for numerous genes, including the genes involved in cancer progression.Citation12 Aberrant NEAT1 expression has been reported in several human malignancies, including leukemia,Citation13 glioma,Citation14 non-small cell lung cancer,Citation15 prostate cancer,Citation16 breast cancerCitation17 and ovarian carcinoma.Citation18 NEAT1 plays important roles in tumorigenesis; specifically, it is involved in the cooperation of multiple paraspeckle-localized RNA-binding proteins, including splicing factor family proteins,Citation19 and it regulates messenger RNA (mRNA) exportCitation12 and controls target gene transcription by protein sequestration into paraspeckles.Citation20 A recent study analyzing multiple samples indicated that the expression level of NEAT1 strongly correlates with the number of tumor nodes, metastasis and TNM stage in HCC patients.Citation21 However, the role of NEAT1 as a driver of this regulation and its function in these molecular mechanisms remains unclear in HCC.
In this study, we found that NEAT1 was upregulated in HCC tissues and cell lines. Furthermore, the upregulation of NEAT1 promoted cell proliferation, migration and invasion in HCC cell lines. To focus on the function and potential molecular mechanism of NEAT1 in HCC, we profiled its gene expression pattern by gene sequencing in a NEAT1-knockdown HepG2 cell line and verified by reverse transcription quantitative polymerase chain reaction (RT-qPCR) that heterogeneous nuclear ribonucleoprotein A2 (hnRNP A2) and IQGAP1 were downregulated and signal transducer and activator of transcription 1 (STAT1), oncostatin M receptor (OSMR) and insulin-like growth factor binding protein 3 (IGFBP3) were upregulated. Based on RNA–protein interaction data obtained from starbase 2.0, RNA immunoprecipitation (RIP) and RNA pull-down assays, we verified that U2 small nuclear RNA auxiliary factor 2 (U2AF65) protein binds to NEAT1. Furthermore, we confirmed that NEAT1 functioned by regulating hnRNP A2 expression, which might be associated with the NEAT1–U2AF65 protein complex.
Materials and methods
Patients and cell lines
Twelve clinical tumor samples were collected from surgical resections of liver tumors conducted at the Department of Hepatobiliary Surgery of the The Calmette Affiliated Hospital of Kunming Medical University, The First Hospital of Kunming, Kunming, Yunnan, People’s Republic of China). Adjacent normal tissues, which are defined as normal in the results, were obtained 2 cm distal from the HCC tissue. These tissues were divided into two groups according to the 2003 American Joint Committee on Cancer TNM classification: grades I–II HCC group (n=5) and grades III–IV HCC group (n=7). All patients provided written informed consent, and ethical consent for this study was granted by the Committee for Ethical Review of Research Involving Human Subjects of the The Calmette Affiliated Hospital of Kunming Medical University, The First Hospital of Kunming. The HCC cell lines HepG2, SMMC-7721 and HCCLM3 were purchased from American Type Culture Collection (Manassas, VA, USA). All HCC cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% fetal bovine serum, 100 U/mL penicillin and 100 μg/mL streptomycin.
Cell transfection
All constructs used to knock down NEAT1 were purchased from RiboBio (People’s Republic of China). After 24 h of culture, the HepG2 and SMMC-7721 cells were transfected using Opti-MEM I and Lipofectamine 2000 (Thermo Fisher Scientific, Waltham, MA, USA) for 6 h at approximately 70% confluence according to the manufacturer’s instructions. The effect of knockdown was detected by RT-qPCR 48 h after transfection. NEAT1 was stably knocked down by selection with gentamicin (G418; Thermo Fisher Scientific) as described previously.Citation14 Cells were stably transduced with retroviral vectors expressing T7-tagged hnRNP A2 complementary DNA (cDNA) to overexpress hnRNP A2 as described previously.Citation22 The following small interfering RNAs (si-RNAs) were used to knock down expression:
Si-NEAT1: Target: GCCTCCGGTCATACTAGTT
Forward: 5′-GCCUCCGGUCAUACUAGUU dTdT-3′
Reverse: 3′-dTdT CGGAGGCCAGUAUGAUCAA-5′
Si-U2AF65: Target: CCAACTACCTGAACGATGA
Forward: 5′-CCAACUACCUGAACGAUGA dTdT-3′
Reverse: 3′-dTdT GGUUGAUGGACUUGCUACU-5′
Si-NC: Forward: 5′-UUCUCCGAACGUGUCACG UTT-3′
Reverse: 5′-ACGUGACACGUUCGGAGAATT-3′
RNA extraction and RT-qPCR
Total RNA was extracted from the cell lines using TRIzol reagent. RNA was then transcribed into cDNA using a High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific) and a reaction volume of 20 μL. Real-time polymerase chain reactions (real-time PCRs) were conducted in a 20 μL reaction volume on a Thermo Fisher Scientific 7500 using an SYBR Green mix. The expression of each RNA was normalized to that of glyceraldehyde 3-phosphate dehydrogenase (GAPDH), and fold changes in expression were calculated using the 2−ΔΔCt method. The following primers were used in this study: NEAT1:
Forward: GUCUGUGUGGAAGGAGGAATT
Reverse: UUCCUCCUUCCACACAGACTT
hnRNP A2: Forward: CAGCAACCTTCTAACTACGGTCC
Reverse: CTGCCTCCTGGACCATAGTTTCGAPDH:
Forward: GAACGGGAAGCTCACTGG
Reverse: GCCTGCTTCACCACCTTCT-3′
IQGAP1: Forward: GGTTATCACCCTCATTCGTTC
Reverse: TTTCCTCTTGGAGTGCTGTCT
STAT1: Forward: CAGAAATGTGAAGGACAAGGTT
Reverse: GATAGGGTCATGTTCGTAGGTG
OSMR: Forward: TGCTTCTCCTGCTTCTGTAATA
Reverse: TGCTTCTCCTGCTTCTGTAATA
IGFBP3: Forward: AGCTCCAGGAAATGCTAGTGA
Reverse: AGGCTGCCCATACTTATCCAC.
Cell proliferation assay (carboxyfluorescein diacetate, succinimidyl ester-labeled assay and cell counting kit-8 assay)
A total of 2×105 HepG2 or SMMC-7721 cells labeled with 2 μM carboxyfluorescein diacetate, succinimidyl ester (CFSE) were seeded in six-well plates 48 h after si-NEAT1 or si-NC treatment. The cells were collected, and the CFSE intensity was detected by flow cytometry to measure cell proliferation at 0 and 72 h after seeding. Forty-eight hours after the si-NEAT1 or si-NC treatment, the cells were seeded in 96-well plates at a density of 2,000 cells per well. A cell counting kit-8 (CCK-8) assay was used to assess cell viability at 0, 12, 24 and 48 h after seeding. The absorbance was measured at 450 nm using an automatic microplate reader.
Analysis of invasiveness and mobility
The invasive and migratory potentials were assessed with an in vitro Transwell (EMD Millipore, Billerica, MA, USA) assay as previously described.Citation23 Briefly, a total of 2×105 HepG2 or SMMC-7721 cells suspended in 200 μL of serum-free DMEM were seeded in the upper chamber, whose porous membrane was coated with Matrigel (BD Biosciences; 200 μg/mL, 100 μL) for the Transwell invasion assay; the membrane remained uncoated for the migration assay. Subsequently, serum was added to the lower chamber (final concentration: 15%) as a chemoattractant. After migration for 24 h or invasion for 48 h, cells that had penetrated the filters were fixed in dry methanol, stained with 0.1% crystal violet and then photographed. The cells on the filters in each group were detached by trypsin. The cells were then counted using a hemocytometer.
RNA sequencing and data analysis
HepG2 cells were transfected with si-NEAT1 or si-NC in duplicate. Forty-eight hours after transfection, total RNA was isolated from the cells using TRIzol (Thermo Fisher Scientific) according to the manufacturer’s protocol. RNA purity was assessed using an ND-1000 Nanodrop instrument. The A260:A280 and A260:A230 ratios of each RNA sample exceeded 1.8 and 2.0, respectively. RNA integrity was evaluated using an Agilent 2200 TapeStation (Agilent Technologies, Santa Clara, CA, USA), and the RNA integrity number evaluation of each sample exceeded 7.0. Briefly, mRNAs were isolated from the total RNA and fragmented to a size of approximately 200 bp. Subsequently, second strand of cDNA was synthesized, followed by adaptor ligation and enrichment with a low cycle according to the instructions of the TruSeq® RNA LT/HT Sample Prep Kit (Illumina, San Diego, CA, USA). The purified library products were evaluated using the Agilent 2200 TapeStation and Qubit® 2.0 (Thermo Fisher Scientific). The samples were then diluted to 10 pM for cluster generation in situ on the HiSeq 2500 pair-end flow cell, followed by sequencing (2×100 bp) on HiSeq 2500. The transformed data of the two groups were compared using Welch’s t-test. The threshold for up- and downregulated genes was defined as a fold change >2.0 and a P-value <0.05. Geneontology and Kyoto Encyclopedia of Genes and Genomes analyses were employed to determine the roles of these differentially expressed mRNAs.
RNA transcription in vitro
The target fragments of RNAs were transcribed using the MEGAscript Kit (Ambion). The DNA templates used for transcription were cloned using a TOPO TA Cloning Kit (Invitrogen). The following primers were used for the RT-qPCR:
Fragment 1 of NEAT1: Forward: CTGAGTTAGATGAGACGAGGGG; Reverse: CTGGCATGGACAAGTTGAAGA
Fragment 2 of NEAT1: Forward: CCTAGCATGTTTGACAGGCG; Reverse: AATGCTAGGACTCACACTGGC
Fragment 3 of NEAT1: Forward: CTGTATTCAGGAGGCTACCATT; Reverse: AACGCCCCAAGTTATTTCATC
Fragment 4 of NEAT1: Forward: AAGGTGGGGAAGACTGAAGAA; Reverse: AGGAACAAATCCAGAAGAGCC
Fragment 5 of NEAT1: Forward: AGCCAAGACTAGAGGGGAAAC; Reverse: ACAACAGCATACCCGAGACTAC.
RNA pulldown
An RNA pull-down analysis was performed as previously described.Citation7 Briefly, biotinylated NEAT1 or RNA fragments were incubated with cell protein extracts (8 μg), which were then targeted with streptavidin beads and washed. The bound proteins were resolved by gel electrophoresis. The specific bands were excised and identified by Western blotting. Additional details are described in the figure legends.
RNA immunoprecipitation
RIP experiments were performed using the Magna RIP RNA-Binding Protein Immunoprecipitation Kit (EMD Millipore) according to the manufacturer’s instructions. Additional details are described in the figure legends.
Electrophoretic mobility shift assay (EMSA)
EMSA experiments were performed using a Light Shift Chemiluminescent RNA EMSA Kit. The target RNAs were labeled with the Pierce™ RNA 3′ End Biotinylation Kit (Thermo Fisher Scientific). A total of 20 μL containing cell extracts, labeled RNA and unlabeled RNA were mixed as described in the figure legends. The masses of these systems were resolved using 6% native polyacrylamide gel electrophoresis. Then, they were transmembraned and photographed by charge coupled device camera using chemiDoc XRS (Bio Rad).
In vivo tumor xenograft studies
The stably transfected cell lines were generated as described previously.Citation24 The axillary fossae of male athymic nude mice aged 4–6 weeks were then bilaterally inoculated with 2×106 stably overexpressing si-NEAT1 HepG2 cells or control cells per site. Tumor size was monitored by measuring the length and width with calipers, and the volumes were calculated with the following formula: (L × W2) ×0.5, where L is the length and W is the width of each tumor. The mice used in this experiment were purchased from Kunming Medical University and maintained under specific pathogen-free conditions at Kunming Medical University in Kunming, Yunnan, People’s Republic of China. All mouse studies were performed in compliance with the Institutional Animal Care and Use Committee policies and the guidelines of Kunming Medical University.
Statistical analysis
All data are presented as the mean ± standard deviation (SD). The data are displayed in graphs, and significance of differences was assessed using GraphPad 5.0 software. Flow cytometry data were analyzed with Flowjo software.
Results
NEAT1 is upregulated in HCC tissues and cell lines
The expression level of NEAT1 was analyzed in 12 HCC tissues, three adjacent normal tissues, and the HepG2, SMMC-7721 and HCCLM3 cell lines using RT-qPCR. HCC tissues and cell lines expressed higher levels of NEAT1, compared with adjacent normal tissues (). Furthermore, the 12 HCC tissues, as shown in , were classified as low-grade HCC (I–II) and high-grade HCC (III–IV) according to the TNM stage, which was determined by the pathologic diagnosis and the clinical status. The data indicated that NEAT1 expression directly correlated with the pathologic grade of HCC ().
Figure 1 The expression of NEAT1 is upregulated in HCC tissues and cell lines.
Abbreviations: ANOVA, analysis of variance; HCC, hepatocellular carcinoma; GAPDH, lyceraldehyde 3-phosphate dehydrogenase; NEAT1, nuclear-enriched abundant transcript 1.
![Figure 1 The expression of NEAT1 is upregulated in HCC tissues and cell lines.](/cms/asset/7d92f366-02d1-4d14-ada2-c6a07a4fc7aa/dott_a_116319_f0001_b.jpg)
Knockdown of NEAT1 inhibited the proliferation, migration and invasion of HCC cells
To assess the function of NEAT1 in HCC cells, the cells were transfected with small interfering RNA (siRNA) against NEAT1, si-NEAT1, and si-NC was used as a control. The efficacy of siRNA knockdown was measured in HCC cell lines (approximately 70% decrease in HepG2 cells and 60% decrease in SMMC-7721 cells; ). Proliferation was assessed with CFSE labeling and a CCK-8 assay, and these experiments indicated that the knockdown of NEAT1 significantly inhibited the proliferation of HepG2 and SMMC-7721 cells, compared with the si-NC group (P<0.01; ). Transwell assays were used to detect the effect of si-NEAT1 on the invasiveness and migration of HCC cells. As shown in , the knockdown of NEAT1 reduced the invasiveness and migration of HepG2 and SMMC-7721 cells compared with the si-NC group, as evidenced by crystal violet staining (). Moreover, significantly fewer cells detached from the Transwell filters in the si-NEAT1 group than in the si-NC group (P<0.001; ).
Figure 2 Knocking down NEAT1 inhibited the proliferation of the hepatocellular carcinoma cell lines HepG2 and SMMC-7721.
Abbreviations: ANOVA, analysis of variance; CCK-8, cell counting kit-8; CFSE, cell tracer: carboxyfluorescein diacetate, succinimidyl ester; GAPDH, lyceraldehyde 3-phosphate dehydrogenase; hnRNP A2, heterogeneous nuclear ribonucleoprotein A2; NC, normal control; NEAT1, nuclear-enriched abundant transcript 1; OD, optical density; SD, standard deviation; si, small intefering.
![Figure 2 Knocking down NEAT1 inhibited the proliferation of the hepatocellular carcinoma cell lines HepG2 and SMMC-7721.](/cms/asset/dd81a778-ee72-4f8d-9974-340d98d5da4d/dott_a_116319_f0002_c.jpg)
Figure 3 Knocking down NEAT1 inhibited the migration and invasion of the hepatocellular carcinoma cell lines HepG2 and SMMC-7721.
Abbreviations: DMEM, Dulbecco’s Modified Eagle’s Medium; hnRNP A2, heterogeneous nuclear ribonucleoprotein A2; NC, normal control; NEAT1, nuclear-enriched abundant transcript 1; SD, standard deviation; si, small intefering.
![Figure 3 Knocking down NEAT1 inhibited the migration and invasion of the hepatocellular carcinoma cell lines HepG2 and SMMC-7721.](/cms/asset/e72a8c3b-3200-4bf3-8e6f-1bd331fe3c22/dott_a_116319_f0003_c.jpg)
Knockdown of NEAT1 altered global gene expression patterns in HCC cells
To study the molecular mechanism of NEAT1 knockdown, global transcriptional changes in HepG2 cells occurring 48 h after NEAT1-siRNA treatment were assessed by gene sequencing. Overall, 377 genes were differentially expressed in NEAT1 knockdown cells (including 229 upregulated and 148 downregulated genes, fold change >2.0 and P-value <0.05). A gene ontology analysis showed that many differentially expressed genes are involved in the biologic processes and molecular functions relevant to cancer pathogenesis, such as cytokine-mediated signaling pathways, the activation of mitogen-activated protein kinase (MAPK) activity, the janus kinase (JAK)–signal transducers and activators of transcription (STAT) cascade (which is involved in the growth hormone signaling pathway), RNA splicing, the regulation of gene expression, RNA binding, cell proliferation and growth (). The associated biologic processes and molecular functions as shown in were the top ten variations after NEAT1 knockdown. The Kyoto Encyclopedia of Genes and Genomes pathway analysis identified variations in the tumor necrosis factor (TNF) signaling pathway, p53 signaling pathway, transcriptional regulation and RIG-I-like receptor signaling pathway after NEAT1 knockdown (). Based on the bioinformatics analysis and the fact that the overexpression of NEAT1 in HCC tissues and cell lines promoted HCC cell proliferation and invasion, we selected 13 genes, including six upregulated and seven downregulated genes, that are involved in the biologic processes relevant to cancer pathogenesis and have been reported as potential tumor suppressors or oncogenes in HCC ().Citation8,Citation25–Citation35 Among these genes, we confirmed the downregulation of hnRNP A2 and IQGAP1 and the upregulation of STAT1, OSMR and IGFBP3 in HepG2 cells using RT-qPCR assays ().
Figure 4 Knockdown of NEAT1 altered global gene expression patterns in HCC cells.
Abbreviations: CCR; C chemokine receptor; GO, gene ontology; HCC, hepatocellular carcinoma; hnRNP A2, heterogeneous nuclear ribonucleoprotein A2; KEGG, Kyoto Encyclopedia of Genes and Genomes; NC, normal control; NEAT1, nuclear-enriched abundant transcript 1; NTP, nucleoside triphosphate; si, small interfering.
![Figure 4 Knockdown of NEAT1 altered global gene expression patterns in HCC cells.](/cms/asset/302e1db0-f75d-4960-b975-469458fe56f5/dott_a_116319_f0004_c.jpg)
Figure 5 Knockdown of NEAT1-regulated genes which were related with HCC progression.
Abbreviations: GAPDH, lyceraldehyde 3-phosphate dehydrogenase; HCC, hepatocellular carcinoma; hnRNP A2, heterogeneous nuclear ribonucleoprotein A2; NEAT1, nuclear-enriched abundant transcript 1; si, small interfering.
![Figure 5 Knockdown of NEAT1-regulated genes which were related with HCC progression.](/cms/asset/c4e01cf7-e492-4f44-98e3-c45627489ade/dott_a_116319_f0005_b.jpg)
Table 1 Selected transcriptional changes
The association of NEAT1 and U2AF65
Several studies have found that many lncRNAs are involved in the molecular regulation pathways by interactions with RNA-binding proteins.Citation5 Therefore, we hypothesized that NEAT1 might affect cellular functions in a similar manner. We screened starbase 2.0 protein–lncRNA interaction data and found that U2AF65 protein has the highest clip read number associated with NEAT1. RIP assays were performed with U2AF65 antibody and nonspecific antibody (IgG control; ) using extracts from HepG2 and SMMC-7721 cells to verify associated RNA enrichment. As shown in , NEAT1 enrichment (but not GAPDH mRNA enrichment) was observed in the U2AF65 antibody group, compared with the IgG control group. Primers against genes that were aberrantly expressed () were also used to detect enrichment using U2AF65 antibody. This experiment showed that mRNA hnRNP A2 was significantly enriched using U2AF65 antibody (). However, a RIP assay using hnRNP A2 antibody did not result in NEAT1 enrichment. We further performed an RNA pull-down assay using full-length NEAT1 (3′ end biotinylated) with extracts from HepG2 and SMMC-7721 cells to identify associated proteins. RNA-associated proteins were resolved by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (), and bands associated with lncRNA-LET at the U2AF65, β-actin and hnRNP A2 locations (highlights 1, 2 and 3 in ) were subjected to Western blot assays. Western blot assays using U2AF65, β-actin and hnRNP A2 antibody identified a full-length NEAT1 band associated with U2AF65 protein, but not β-actin or hnRNP A2 protein (). Several studies showed that some lncRNAs bind to RNA-binding proteins by a secondary structural element or a specific fragment.Citation36 NEAT1 and U2AF65 interreaction data in starbase 2.0 showed target sites clip read numbers that were mostly located at the 3′ end and 5′ end of 3,750 bp NEAT1. Therefore, five RNA fragments (500–1,000 bp) of NEAT1 transcribed in vitro were 3′ end biotinylated and used in RNA pull-down and Western blot assays with U2AF65 antibody. As shown in , U2AF65 protein was associated with fragments 2 and 5 of NEAT1, as detected by Western blot assays. The biotinylated RNA fragment 2 of NEAT1 was used in a subsequent EMSA because the signal intensity of this protein was higher than that of fragment 5 ().
Figure 6 U2AF65 binds to NEAT1 and mRNA hnRNP A2.
Abbreviations: CCD, charge coupled device; GAPDH, lyceraldehyde 3-phosphate dehydrogenase; hnRNP A2, heterogeneous nuclear ribonucleoprotein A2; IgG, immuglobulin G; NEAT1, nuclear-enriched abundant transcript 1; RIP, RNA immunoprecipitation; RT-qPCR, reverse transcription quantitative polymerase chain reaction; SDS, sodium dodecyl sulfate; U2AF65, U2 small nuclear RNA auxiliary factor 2.
![Figure 6 U2AF65 binds to NEAT1 and mRNA hnRNP A2.](/cms/asset/2cc1caef-cf54-4c74-8358-cf8eed5bbc65/dott_a_116319_f0006_b.jpg)
NEAT1 regulated hnRNP A2 expression through U2AF65
U2AF65 is an essential splicing factor of polypyrimidine tract pre-mRNACitation37 and also known as a competitor of the hnRNP protein family in the regulation of transcript function.Citation38 However, the role of U2AF65 in NEAT1-hnRNP A2 regulation remains unknown. A Western blot assay and immunohistochemistry assays indicated that knocking down lncRNA NEAT1 downregulated hnRNP A2 protein, but not U2AF65 protein expression in HepG2 cells (). According to RIP and RNA pull-down assays, NEAT1 did not directly bind to hnRNP A2 protein. Moreover, EMSA showed that hnRNP mRNA competed with NEAT1 fragment 2 to bind proteins in HepG2 cell extracts (). We hypothesized that NEAT1 regulates hnRNP A2 expression through the NEAT1–U2AF65 complex. Therefore, U2AF65 was knocked down and hnRNP A2 expression was detected by Western blot and immunohistochemistry assays. Western blot and immunohistochemistry assays indicated that knocking down U2AF65 also downregulated hnRNP A2. According to these data, U2AF65 may participate in NEAT1-hnRNP A2 regulation ().
Figure 7 Knocking down NEAT1 and U2AF65 downregulated hnRNP A2 expression.
Abbreviations: CCD, charge coupled device; DAB, diaminobenzidine; EMSA, electrophoretic mobility shift assay; hnRNP A2, heterogeneous nuclear ribonucleoprotein A2; HRP, horseradish peroxidase; mRNA, messenger RNA; NC, normal control; NEAT1, nuclear-enriched abundant transcript 1; si, small interfering; U2AF65, U2 small nuclear RNA auxiliary factor 2.
![Figure 7 Knocking down NEAT1 and U2AF65 downregulated hnRNP A2 expression.](/cms/asset/137dee36-c468-4970-a130-dfe17acbcd84/dott_a_116319_f0007_c.jpg)
Overexpression of hnRNP A2 rescued the proliferation and invasion in HCC cells that express low levels of NEAT1
hnRNP A2 is an essential splicing factor that promotes HCC proliferation and invasionCitation39 and activates alternative splicing switch that downregulates a dominant-negative isoform of A-Raf, which leads to activation of the Raf-MEK-ERK pathway and cellular transformation.Citation22 Our data indicated that NEAT1 participates in hnRNP A2 regulation. To verify that NEAT1 functions by hnRNP A2 regulation, hnRNP A2 was overexpressed in NEAT1 knockdown cells using a retrovirus that encodes hnRNP A2 (), as described previously.Citation22 Control cells were transfected with an empty vector (lv-control). Subsequent proliferation and invasion assays indicated that the overexpression of hnRNP A2 promoted the proliferation and invasion of NEAT1 knockdown cells, compared with the lv-control group (). These data suggest that NEAT1 promoted HCC cell proliferation and invasion by regulating hnRNP A2.
Figure 8 The overexpression of hnRNP A2 rescued the proliferation and invasion of HCC cells expressing low levels of lncRNA-NEAT1.
Abbreviations: ANOVA, analysis of variance; CCK-8, cell counting kit-8; DMEM, Dulbecco’s Modified Eagle’s Medium; HCC, hepatocellular carcinoma; hnRNP A2, heterogeneous nuclear ribonucleoprotein A2; lncRNA, long noncoding RNAs; NC, normal control; NEAT1, nuclear-enriched abundant transcript 1; OD, optical density; si, small interfering.
![Figure 8 The overexpression of hnRNP A2 rescued the proliferation and invasion of HCC cells expressing low levels of lncRNA-NEAT1.](/cms/asset/2c96931b-4a93-40c5-b3ba-27d62a0e278e/dott_a_116319_f0008_c.jpg)
Knockdown of NEAT1 reduced HepG2 cell growth and downregulated hnRNP A2 expression in vivo
HepG2 cells were transfected with si-NEAT1 and expressed lower level of NEAT1 than the control cell line. Then the hnRNP A2 expression level was tested to explore NEAT1-hnRNP A2 regulation in vivo. Cells of either line were bilaterally injected into the axillary fossa of male athymic nude mice, and the tumor growth activity and hnRNP A2 expression were measured. As shown in , the average volume of tumors derived from the si-NEAT1 group 14 days after xenograft transplantation was significantly smaller than that of the control group (n=4 animals per group, P<0.001). Furthermore, total RNA was also extracted from the tumors in each group to measure the expression level of hnRNP A2 by RT-qPCR. The results revealed that the expression of hnRNP A2 mRNA was significantly lower in the si-NEAT1 group than in the control group (P<0.001; ). Furthermore, Western blot assays indicated that the protein expression of hnRNP A2 was decreased in the si-NEAT1 group compared with the control group (); a representative immunohistochemistry image is shown in .
Figure 9 Knocking down NEAT1 inhibited HepG2 cell growth and downregulated hnRNP A2 expression in vivo.
Abbreviations: GAPDH, lyceraldehyde 3-phosphate dehydrogenase; hnRNP A2, heterogeneous nuclear ribonucleoprotein A2; IHC, immunohistochemistry; NC, normal control; NEAT1, nuclear-enriched abundant transcript 1; si, small interfering; U2AF65, U2 small nuclear RNA auxiliary factor 2.
![Figure 9 Knocking down NEAT1 inhibited HepG2 cell growth and downregulated hnRNP A2 expression in vivo.](/cms/asset/90617cfc-3ebb-4651-8e6d-333c0cea2bf9/dott_a_116319_f0009_c.jpg)
Discussion
According to a previous study, NEAT1 expression is higher in cancers than in normal tissues, including leukemia, glioma, non-small cell lung cancer, prostate cancer, breast cancer, ovarian carcinoma and HCC. NEAT1 expression was associated with metastasis-associated lung adenocarcinoma transcript 1 (MALAT1), which is a well-known oncogene because it regulates the alternative splicing of endogenous target genes involved in cancers, including HCC.Citation21 The biologic mechanisms of NEAT1 regulation in cancer have gradually been revealed in recent studies. In prostate cancer, NEAT1 is involved in the modulation of oncogenic growth by altering the epigenetic landscape.Citation18 Induced by hypoxia in hypoxia-inducible factors transcriptional pathways, NEAT1 also plays an important role in promoting proliferation and reducing apoptosis, which contributes to tumorigenesis.Citation40 In glioma, NEAT1 regulates glioma cell proliferation, invasion and migration through the miR-449b-5p/c-Met axis.Citation14 Moreover, a study of HCC patients indicated that the expression level of NEAT1 strongly correlated with tumorigenesis and metastasis, including the number of tumor nodes, metastasis, portal vein tumor embolus, vascular invasion, tumor capsular infiltration and TNM stage.Citation22 However, the specific functions, regulatory roles and biologic mechanisms of NEAT1 in HCC remained unclear. We verified that NEAT1 is upregulated in HCC tissues and cell lines and affects HCC (). Further study indicated that NEAT1 promotes cell proliferation, migration and invasion in the HCC cell lines HepG2 and SMMC-7721 ( and ). RNA sequencing and data analyses indicated that NEAT1 plays important roles in the regulation of pathways and genes in HCC cells (). We also verified that hnRNP A2 and IQGAP1 were downregulated and that STAT1, OSMR and IGFBP3 were upregulated in HCC cells ().
LncRNA–protein complexes have been shown to initiate unique transcriptional programs that result in various functions by different combinations of RNA-binding protein interactions.Citation5 Specific hypothesis-driven studies confirmed this theory in HCC. LncRNA-LET, a tumor suppressor, binds to NF90, to affect hypoxia-inducible factor-1a mRNA accumulation and stability under hypoxic conditions in HCC.Citation7 LncRNA-MEG3,Citation41 lncRNA Rs10680577,Citation42 LncRNA-HEIHCitation43 and HOTTIPCitation44 function through lncRNA–protein complexes according to reports. Because NEAT1 plays important roles in promoting the proliferation and invasion of HCC cells and is involved in gene regulation, we screened the RNA–protein interaction data in starbase 2.0. Specifically, we searched for proteins that were either up- or downregulated in NEAT1 knockdown cells () and determined whether they directly bound to NEAT1. However, the star-base 2.0 data identified few possible interactions between NEAT1 and the proteins we selected based on the clip read number. Therefore, we hypothesized that NEAT1 functions by gene regulation, which might be associated with the NEAT1–RNA-binding protein complex. We screened the RNA–protein interaction data in starbase 2.0 and found that U2AF65, polypyrimidine tract-binding protein (PTB), eukaryotic initiation factor 4A-III (eIF4AIII) and fused in sarcoma (FUS) might interact with NEAT1. Using RIP and RNA pull-down assays, we found that NEAT1 binds to U2AF65 protein and that the binding target might be located in NEAT1 fragments 2 (chr11: 65, 191, 001–65, 191, 516) and 5 (chr11: 65, 193, 299–65, 194, 003) in vitro (). Furthermore, a RIP assay showed that hnRNP A2 mRNA was enriched by U2AF65 protein (). This finding suggested that U2AF65 interacts with hnRNP A2 mRNA, which was downregulated in NEAT1-knockdown HCC cells. hnRNP A2 was reported to be an essential splicing factor that promotes cell proliferation and invasion and correlates with poor outcome in HCC patients.Citation22,Citation39 Specifically, this factor activates the Raf-MEK-ERK pathway, which results in cellular transformation in HCC.Citation40 A previous study indicated that lncRNA functions through a specific region which was the combination target of RNA–protein.Citation8 Because U2AF65 protein interacts with NEAT1 and hnRNP A2 mRNA, the NEAT1–U2AF65–hnRNP A2 complex was further explored in HCC cells. Our RNA pull-down data suggested that NEAT1 directly binds to U2AF65 protein, but not hnRNP A2 protein (). Knocking down NEAT1 or U2AF65 reduced the downregulation of hnRNP A2 transcript and protein. An EMSA showed NEAT1 fragment 2 (chr11: 65, 191, 001–65, 191, 516), which specifically interacts with U2AF65, competes with hnRNP A2 mRNA to bind proteins in vitro. Our future studies will focus on the specific region that regulates the function of NEAT1 in HCC. Our updated data obtained using recombinant protein will confirm that NEAT1 competes with hnRNP A2 to bind U2AF65 protein. Furthermore, overexpression assays will be used to confirm that NEAT1 fragment 2 (chr11: 65, 191, 001–65, 191, 516) and the 515 nt region regulate hnRNP A2 and tumorigenesis in HCC. Taken together, our data indicate that NEAT1 regulates hnRNP A2 expression in HCC cells, and this regulation might be associated with the NEAT1–U2AF65 protein complex.
NEAT1 has been previously described to function by regulating the epigenetic landscape.Citation14,Citation18,Citation21 As demonstrated above, knocking down NEAT1 decreases hnRNP A2 expression, which is strongly correlated with HCC tumorigenesis. However, whether NEAT1 promotes HCC cell proliferation and invasion by regulating hnRNP A2 regulation remains to be verified. To explore the correlation between NEAT1 and hnRNP A2 in HCC tumorigenesis, we compared the proliferative and invasive potential of si-NEAT1-transfected and si-NEAT1 and hnRNP A2-cotransfected cells. Our data indicated that the overexpression of hnRNP A2 rescued the proliferation and invasion inhibited by NEAT1 knockdown in HCC cells (). Because NEAT1 was also found to regulate hnRNP A2 expression, this finding suggested that NEAT1 might promote cell proliferation and invasion by regulating hnRNP A2.
Analyses of clinical pathologic data, in vitro assays based on knockdown/knockout or overexpression models in cell lines and in vivo xenograft models have confirmed that lncRNAs regulate tumorigenesis and metastasis.Citation36 Therefore, we compared the tumor growth of NEAT1-knockdown cells and control cells in athymic nude mice. Our data indicated that knocking down NEAT1 inhibited tumor growth in vivo. Interestingly, hnRNP A2 expression was downregulated in the tumors of the NEAT1 knockdown group. These data suggested that NEAT1 promotes tumor growth and affects hnRNP A2 in vivo.
In summary, this work suggests that the lncRNA NEAT1 is an oncogene and is strongly correlated with altered hnRNP A2 expression. Thus, NEAT1-hnRNP A2 regulation might be a potential mechanism of HCC progression.
Acknowledgments
The authors would like to thank Dr Lei Zhang from the Biomedical Research Center of The Calmette Affiliated Hospital of Kunming Medical University, The First Hospital of Kunming, for helping us with molecular experiments.
Disclosure
This study was supported by grants to Li Li from Kunming Science and Technology Bureau (2012-02-03-A-H-04-0001). The other authors report no conflicts of interest in this work.
References
- DingJLuQQuyangYA long noncoding RNA regulates photoperiod-sensitive male sterility, an essential component of hybrid riceProc Natl Acad Sci U S A201210972654265922308482
- CalvisiDFLaduSPinnaFSKP2 and CKS1 promote degradation of cell cycle regulators and are associated with hepatocellular carcinoma prognosisGastroenterology2009137518161826e1e1019686743
- JendrzejewskiJHeHRadomskaHSThe polymorphism rs944289 predisposes to papillary thyroid carcinoma through a large intergenic non-coding RNA gene of tumor suppressor typeProc Natl Acad Sci U S A2012109228646865122586128
- SpizzoRAlmeidaMIColombattiACalinGALong non-coding RNAs and cancer: a new frontier of translational research?Oncogene201231434577458722266873
- GuttmanMDonagheyJCareyBWlincRNAs act in the circuitry controlling pluripotency and differentiationNature2011477736429530021874018
- KogoRShimamuraTMimoriKLong noncoding RNA HOTAIR regulates polycomb-dependent chromatin modification and is associated with poor prognosis in colorectal cancersCancer Res201171206320632621862635
- YangFHuoXSYuanSXRepression of the long noncoding RNA-LET by histone deacetylase 3 contributes to hypoxia-mediated metastasisMol Cell20134961083109623395002
- MohamadkhaniALong noncoding RNAs in interaction with RNA binding proteins in hepatocellular carcinomaHepat Mon2014145e1879424910706
- HuangJLZhengLHuYWWangQCharacteristics of long non-coding RNA and its relation to hepatocellular carcinomaCarcinogenesis201435350751424296588
- NaganumaTHiroseTParaspeckle formation during the biogenesis of long non-coding RNAsRNA Biol201310345646123324609
- GuruSCAgarwalSKManickamPA transcript map for the 2.8-Mb region containing the multiple endocrine neoplasia type 1 locusGenome Res1997777257359253601
- ClemsonCMHutchinsonJNSaraSAAn architectural role for a nuclear noncoding RNA: NEAT1 RNA is essential for the structure of paraspecklesMol Cell200933671772619217333
- ZengCXuYXuLInhibition of long non-coding RNA NEAT1 impairs myeloid differentiation in acute promyelocytic leukemia cellsBMC Cancer20141469325245097
- ZhenLYun-HuiLHong-YuDJunMYi-LongYLong noncoding RNA NEAT1 promotes glioma pathogenesis by regulating miR-449b-5p/c-Met axisTumour Biol201637167368326242266
- PanLJZhongTFTangRXUpregulation and clinicopathological significance of long non-coding NEAT1 RNA in NSCLC tissuesAsian Pac J Cancer Prev20151672851285525854373
- KeHZhaoLFengXNEAT1 is required for survival of breast cancer cells through FUS and miR-548Gene Regul Syst Bio201610Suppl 11117
- KimYSHwanJDBaeSBaeDHShickWAIdentification of differentially expressed genes using an annealing control primer system in stage III serous ovarian carcinomaBMC Cancer20101057620969748
- ChakravartyDSbonerANairSSThe oestrogen receptor alpha-regulated lncRNA NEAT1 is a critical modulator of prostate cancerNat Commun20145538325415230
- CooperDRCarterGLiPPatelRWatsonJEPatelNALong non-coding RNA NEAT1 associates with SRp40 to temporally regulate PPARgamma2 splicing during adipogenesis in 3T3-L1 cellsGenes (Basel)2014541050106325437750
- HiroseTVirnicchiGTanigawaANEAT1 long noncoding RNA regulates transcription via protein sequestration within subnuclear bodiesMol Biol Cell201425116918324173718
- GuoSChenWLuoYClinical implication of long non-coding RNA NEAT1 expression in hepatocellular carcinoma patientsInt J Clin Exp Pathol2015855395540226191242
- ShiloABen HurVDenichenkoPSplicing factor hnRNP A2 activates the Ras-MAPK-ERK pathway by controlling A-Raf splicing in hepatocellular carcinoma developmentRNA201420450551524572810
- HuangGHuZLiMECRG2 inhibits cancer cell migration, invasion and metastasis through the down-regulation of uPA/plasmin activityCarcinogenesis200728112274228117602171
- WanHYGuoLMLiuTLiuMLiXTangHRegulation of the transcription factor NF-kappaB1 by microRNA-9 in human gastric adenocarcinomaMol Cancer201091620102618
- HuJCheLLiLCo-activation of AKT and c-Met triggers rapid hepatocellular carcinoma development via the mTORC1/FASN pathway in miceSci Rep201662048426857837
- TianYEXieXULinYTanGZhongWUAndrogen receptor in hepatocarcinogenesis: Recent developments and perspectivesOncol Lett2015951983198826136999
- TanaseAMMarchioADumitrascuTMutation spectrum of hepatocellular carcinoma from eastern-European patients betrays the impact of a complex exposomeJ Expo Sci Environ Epidemiol201525325626324736102
- MizunoHHondaMShirasakiTHeterogeneous nuclear ribonucleoprotein A2/B1 in association with hTERT is a potential biomarker for hepatocellular carcinomaLiver Int20123271146115522372738
- JinXLiuYLiuJThe overexpression of IQGAP1 and beta-catenin is associated with tumor progression in hepatocellular carcinoma in vitro and in vivoPLoS One2015108e013377026252773
- LiuZDouCJiaYRIG-I suppresses the migration and invasion of hepatocellular carcinoma cells by regulating MMP9Int J Oncol20154641710172025626059
- XueFHiggsBWHuangJHERC5 is a prognostic biomarker for post-liver transplant recurrent human hepatocellular carcinomaJ Transl Med20151337926653219
- ChenJWangHWangJHuangSZhangWSTAT1 inhibits human hepatocellular carcinoma cell growth through induction of p53 and Fbxw7Cancer Cell Int20151511126617467
- EhltingCBöhmerOHahnelMJOncostatin M regulates SOCS3 mRNA stability via the MEK-ERK1/2-pathway independent of p38(MAPK)/MK2Cell Signal201527355556725562430
- LinYCWuHCLiaoCCChouYCPanSFChiuCMSecretion of one adipokine Nampt/Visfatin suppresses the inflammatory stress-induced NF-kappaB activity and affects Nampt-dependent cell viability in Huh-7 cellsMediators Inflamm2015201539247125814788
- HanJJXueDWHanQRInduction of apoptosis by IGFBP3 overexpression in hepatocellular carcinoma cellsAsian Pac J Cancer Prev20141523100851008925556430
- TsaiMCSpitaleRCChangHYLong intergenic noncoding RNAs: new links in cancer progressionCancer Res20117113721199792
- AgrawalAAMcLaughlinKJJenkinsJLKielkopfCLStructure-guided U2AF65 variant improves recognition and splicing of a defective pre-mRNAProc Natl Acad Sci U S A201411149174201742525422459
- ZarnackKKönigJTajnikMDirect competition between hnRNP C and U2AF65 protects the transcriptome from the exonization of Alu elementsCell2013152345346623374342
- CuiHWuFSunYFanGWangQUp-regulation and subcellular localization of hnRNP A2/B1 in the development of hepatocellular carcinomaBMC Cancer20101035620604928
- KarrethFATayYPernaDIn vivo identification of tumor-suppressive PTEN ceRNAs in an oncogenic BRAF-induced mouse model of melanomaCell2011147238239522000016
- ChangLWangGJiaTArmored long non-coding RNA MEG3 targeting EGFR based on recombinant MS2 bacteriophage virus-like particles against hepatocellular carcinomaOncotarget2016717239882400426992211
- ZhuZGaoXHeYAn insertion/deletion polymorphism within RERT-lncRNA modulates hepatocellular carcinoma riskCancer Res201272236163617223026137
- YangFZhangLHuoXSLong noncoding RNA high expression in hepatocellular carcinoma facilitates tumor growth through enhancer of zeste homolog 2 in humansHepatology20115451679168921769904
- QuagliataLMatterMSPiscuoglioSLong noncoding RNA HOTTIP/HOXA13 expression is associated with disease progression and predicts outcome in hepatocellular carcinoma patientsHepatology201459391192324114970