Involvement of ERK1/2 signalling and growth-related molecules’ expression in response to heat stress-induced damage in rat jejunum and IEC-6 cells

Abstract

Our previous studies found small intestine epithelial tissues from several different animals (including rats, pigs and chickens) became significantly damaged following exposure to extreme heat. However, damaged tissue was rapidly repaired or regenerated in the following few days. Growth-related molecules are critical for cellular survival and promote endothelial cell proliferation and migration. The ERK1/2 signalling pathway is reported to regulate the growth and adaptation of endothelial cells to both physiological and pathological stimuli. However, little information is available concerning both growth-related molecules and ERK1/2 in response to heat stress. Herein, we employed both live rats and rat IEC-6 cells to investigate growth-related molecule expression and ERK1/2 activation in heat stress. Heat stress caused significant morphological damage to rat intestinal tissue and IEC-6 cells, reduced cell growth and proliferation, induced apoptosis, altered growth-related molecule mRNA expression and increased ERK1/2 phosphorylation. Addition of U0126 (a selective inhibitor of MEK kinase responsible for ERK phosphorylation) combined with heat stress exacerbated the morphological damage and apoptosis. With the addition of U0126, further up- or down-regulation of Egfr, Ctgf, Tgif, Vegfa, Okl38 and Gdf15 in response to heat stress was observed. In conclusion, extreme heat stress caused obvious damage to rat jejunum and IEC-6 cells. Both growth-related molecule expression and ERK1/2 phosphorylation were involved in response to heat stress. ERK1/2 inhibition exacerbated apoptosis and affected growth factor mRNA expression in heat stress.

• ERK1/2
• growth-related molecules
• heat stress
• IEC-6 Cell
• microarray
• rat
• small intestine

Introduction

The intestinal epithelium is directly exposed to a large assortment of nutrients, microbes and exogenous toxins providing both a barrier and absorptive function [1]. However, many stressors such as radiation, lipopolysaccharides (LPS), pharmacological drugs, endotoxins and heat can cause damage to the intestinal epithelium [2]. When animals become exposed to environmental temperatures greater than their thermoneutral temperature, their peripheral blood flow is increased to dissipate internal body heat, thereby resulting in a significant reduction in blood flow to the small intestine [3], [4]. During this time, the epithelial tissue of the small intestine can experience ischaemic and hypoxic conditions, resulting in tissue damage, which, in turn, can lead to diarrhoea and an increased risk of morbidity and mortality [5]. The intestinal epithelium has very rapid turnover rates as mature differentiated epithelial cells are shed into the lumen and are continuously replaced by the progeny of stem cells, so the damaged epithelial cells are continually and rapidly replaced by new cells, crucial for maintaining sufficient intestinal function [6], [7].

Growth-related molecules refer to naturally occurring agents capable of stimulating cellular growth, proliferation and cellular differentiation, which are important in regulating a variety of cellular processes [8]. Growth-related molecules can promote epithelial proliferation and migration, as well as provide critical survival factors for epithelial cells [9]. The extracellular-regulated kinase 1/2 (ERK1/2) signalling pathway is known as a critical regulator of cellular differentiation, proliferation, stress responsiveness, and apoptosis [10]. ERK1/2 activation is understood to regulate cellular growth and adaptation in response to both physiological and pathological stimuli [11]. Thus, investigating the expression of specific growth-related molecules and ERK1/2 activation may provide insight into the possible mechanisms underlying heat stress-induced damage and repair/regeneration in the small intestinal epithelium. The rat intestinal epithelial cell line (IEC-6), is a homogenous population of epithelial-like cells commonly used as a model to elucidate the mechanism of intestinal epithelial cell differentiation, growth, and wound healing [12]. Using the rat IEC-6 cell line, we investigated cell morphology, viability, apoptosis, growth-related molecule mRNA expression, as well as ERK1/2 signalling in response to heat stress.

Materials and methods

In vivo studies

Ethical approval. All experimental protocols were approved by the Committee for the Care and Use of Experimental Animals, Beijing University of Agriculture.

Animal experimental groups. Forty-eight male Sprague-Dawley rats weighing 200 ± 20 g (obtained from Beijing Vital River Laboratory, Animal Technology Co., Beijing, China) were acclimated to 25°C, 60% relative humidity (RH) and maintained under a 12 h:12 h light:dark cycle. Food and water were provided ad libitum for 7 days. On day 8 the rats were randomly assorted into control or heat-stressed groups. Each group consisted of 24 rats, which were housed in plastic cages (400 mm × 300 mm × 180 mm) with a layer of soft woodchips. Feed (200 g) and water (400 mL) were provided daily.

Treatment. Rats in the control group were housed in a controlled environment (25°C, 60% relative humidity (RH)); while rats in the heat-stressed group were housed under control group conditions, but exposed to 40°C and 60% relative humidity between 11:00 am and 1:00 pm daily for ten consecutive days. On days 1, 3, 6 and 10, six rats from each group were sacrificed immediately following the 2-h heat exposure time period.

Sampling. Rat body temperature was recorded daily before and after heat exposure using a thermistor probe connected to a digital thermometer. The probe was inserted 40 mm into the rectum of each rat and the animal held stationary for 30 s to record the true rectal temperature. Body surface temperature was also recorded daily before and after heat exposure using both an infrared and contact thermometer (Fluke 561, Evered, Washington, USA). Blood samples collected were stored at 37°C for 60 min, prior to being centrifuged at 3000 g for 10 min; serum was collected and stored at −80°C until required. Following removal of the intestine, it was immediately irrigated with physiological saline to remove all intestinal contents before being sectioned into the duodenum (15 mm from the pylorus), the distal jejunum–ileum (half of the remaining small intestine up to the caecum) and the ileum (20 mm proximal to the caecum). Each intestinal section was divided into three pieces: one fixed in 10% buffered formalin phosphate for histological analysis; one for cDNA microarray analysis; and one stored at −80°C. Total serum cortisol concentration was determined using an iodine (I¹²⁵) cortisol radioimmunoassay kit, performed according to the manufacturer's instructions (Beijing Chemclin Biotech).

Fixing intestinal sections and staining. Small intestine tissue samples were promptly rinsed with physiological saline and immediately fixed in 10% buffered formalin phosphate following removal from the animal. The formalin-fixed samples were embedded in paraffin and transversely sectioned (5 µm thick). After deparaffinisation and dehydration, the sections of duodenum, jejunum and ileum (HyClone, Logan, Utah, USA) were stained with hematoxylin and eosin (Sigma, St. Louis, MO, USA). Microstructures of the small intestine were observed using a BH2 Olympus microscope (DP71, Olympus, Tokyo, Japan) and analysed using an Olympus Image Analysis System (Olympus 6.0).

In vitro studies

IEC-6 cell culture. IEC-6 cells (CRL21592, obtained from Peking Union Medical College) were cultured in DMEM containing 5% (v/v) fetal bovine serum (HyClone, Logun, Utah, USA), 2 mg/L insulin, 50 IU/mL penicillin and 50 µg/mL streptomycin at 37°C and 5% (v/v) CO₂. The medium was changed 24 h following initial cell plating.

Treatment and morphology observation. The control cells were strictly regulated at 37°C and 5% CO₂, while heat-stressed cells were exposed to 42°C for 3h at 5% CO₂. Changes in cell morphology following heat stress were observed using a phase-contrast inverted biological microscope (IX71/IX2, Olympus).

MTT and FACS assay. To measure cell proliferation, equivalent numbers of IEC-6 cells were plated on 96-well multiplates and cultured in DMEM containing 5% fetal bovine serum at a density of 1.2 × 10⁵ cells/mL. After the cells were attached to the multiplate, control cells were maintained at 37°C, while heat-stressed cells were submitted to 42°C for 2, 3, 4 or 5 h. Following the heat stress period, 10 µL of MTT (10 mg/mL) was added to each well then incubated at 37°C for 4 h. Well media was aspirated and the formazan product dissolved using dimethyl sulphoxide. The remaining formazan product was analysed using a microplate reader (BIO-RAD, Foster, California, USA) at a fixed absorption wavelength of 570 nm. Using the MTT assay it was determined that subjecting the intestinal cells to 42°C for 3 h caused the greatest level of stress.

To analyse apoptosis, IEC-6 cells were divided into control (37°C), heat-stressed (42°C for 3 h), and ERK1/2 inhibitor (42°C for 3 h + 20 µmol/L U0126 Tocris Bioscience, St. Louis, Missouri, USA) groups. Following each specific treatment, all IEC-6 cells were stained with annexin V/propidium iodide (PI) (Invitrogen, Carlsbad, California, USA), before FACS analysis was performed according to manufacturer's instructions (Beckman, Fullerton, California, USA).

Total RNA expression and reverse transcription. Total RNA was isolated from the small intestine and IEC-6 cells using a phenol and guanidine isothiocyanate-based TRIzol® reagent (Invitrogen). RNA concentration and purity were assessed using a spectrophotometer (SmartSpec plus, BIO-RAD) utilising the OD260/OD280 ratio. Total RNA was reverse transcribed as follows: 2 µg of RNA isolated from each sample was added to 25 µL of reaction solution comprising 2 µL oligo-dT18, 5 µL dNTP, 1 µL RNase inhibitor, 1 µL M-MLV transcriptase, 5 µL M-MLV reverse transcription (RT) reaction buffer (Promega, Madison, Wisconsin, USA) and 11 µL RNase-free water. The parameters for the reverse-transcription procedure, based on the manufacturer's instructions (Promega), were: 70°C for 5 min followed by 42°C for 2 h. The RT products (cDNA) were stored at −20°C for subsequent PCR.

DNA microarray

RNA extraction and target labelling. Total RNA was isolated from small intestine tissue using a phenol and guanidine isothiocyanate-based TRIzol reagent in accordance with manufacturer's instructions. RNA quality of each sample was determined and recorded using an RNA 6000 LabChip Kit, and the Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA). RNA consistently had a 28S/18S ratio of ∼1.4. RNA was purified using a QIAGEN RNeasy ® Mini Kit (74106, QIAGEN, Valencia, California, USA) and amplified using a low RNA input linear amplification kit (5184-3523, Agilent). Each RNA sample was annealed with a primer containing a poly-dT and a T7 polymerase promoter. Reverse transcriptase produced primary and secondary cDNA strands. T7 RNA polymerase was then used to create cRNA from the double stranded cDNA by incorporating cyanine-3-labelled cytidine 5-triphosphate. The quality of the labelled cRNA was again verified and the absolute concentration was measured using a spectrophotometer (Nanodrop ND1000, Wilmington, Delaware, USA).

Hybridisation, scanning and feature extraction. The cRNA was hybridised in equal amounts to six arrays using a gene expression hybridisation kit (5188-5242, Agilent). Hybridisation was performed at 60°C for 17 h with Agilent whole rat genome arrays (G4131F, Agilent). The arrays were washed using a gene expression wash buffer kit (5188-5327, Agilent), Stabilisation and dehydration was performed (5185-5979, Agilent). The arrays were scanned on a Microarray (G2565BA, Agilent) and the subsequent data compiled with Agilent feature extraction software. All steps from RNA amplification to the final scanner output were conducted by a private contractor (Shanghai Biochip, China).

Microarray data analysis. Array normalisations and error detection were carried out using Silicon Genetics’ GeneSpring GX Version 10.0 (Agilent), via the enhanced Agilent feature extraction import preprocessor. First, values of poor quality intensities and low dependability were removed using a ‘filter on flags’ feature, where standardised software algorithms determined which spots were ‘present’, ‘marginal’, or ‘absent’. Spots were considered ‘present’ only when the output was uniform, non-saturated and significantly greater than the background. Spots that satisfied these requirements but were deemed outliers relative to the typical values for the other genes were considered ‘marginal’. Filters were set to retain only the present and marginal values for further analysis. Data were normalised using algorithms supplied with the feature extraction software. After data normalisation, a final quality-control filter was applied, where genes expressing excessive biological variability were discarded. Data were further analysed using GeneSpring to reveal significant genes.

Validation of growth factor mRNA expression using real time PCR

To corroborate the relative changes in gene expression in response to heat stress both in vivo and in vitro identified by the oligonucleotide microarrays, we employed real time quantitative reverse transcriptase-PCR (RT-PCR). Quantitative PCR analysis was carried out using the DNA Engine Mx3000P® fluorescence detection system (Stratagene, La Jolla, California, USA) according to optimised PCR protocols, and using Brilliant SYBR Green QPCR Master Mix (Stratagene, La Jolla, California, USA), containing a double-stranded DNA-specific fluorescent dye. β-actin was always amplified in parallel with the target gene. The cDNA of each sample was subjected to real-time RT-PCR using the primer pairs listed in Table I. The PCR reaction system (20 µL in total) comprised of 10 µL SYBR Green qPCR mix, 0.3 µL reference dye, 1 µL of each primer (both 10 µmol/L), and 1 µL of cDNA template. Cycling conditions were: 94°C for 10 min, followed by 40 cycles of 94°C for 30 s, 56°C for 30 s and 72°C for 40 s. Dissociation was initiated by 95°C for 1 min, and the melting curve (from 55°–95°C at 0.2°C/s) was measured continuously by fluorescence. Expression levels were determined using the relative threshold cycle (CT) method as described by the manufacturer (Stratagene). Each gene was calculated by evaluating the expression 2^ΔΔCT, where ΔΔCT is the result of subtracting heat-stressed [CT_gene–CT_β-actin] from control [CT_gene–CT_β-actin].

Table I.  Primers used for PCR.

Description	Accession number	Primer sequence	Product (bp)
β-actin	NM_031144	Forward: TTGTCCCTGTATGCCTCTGG	218
		Reverse: ATGTCACGCACGATTTCCC
Hsp70	NM_031971	Forward: CGTGCCCGCCTACTTCA	280
		Reverse: CACCAGCCGGTTGTCGA
Alb	NM_134326	Forward: ACTGCCCTGTGTGGAAGAC	320
		Reverse: GAAGTCACCCATCACCGTC
Gdf15	NM_019216	Forward: TCTCGAGGACCTAGGTTGGA	197
		Reverse: TAAGAACCACCGGGGTGTAG
Gdf9	NM_021672	Forward: ACGCGTAAAACCACAGCAC	156
		Reverse: ACACACTGGTCGTTGCCATA
Vegfa	NM_031836	Forward: GATCATGCGGATCAAACCTCACC	613
		Reverse: CCTCCGGACCCAAAGTGCTC
Pdgfa	NM_012801	Forward: CAGTGTCAAGGTGGCCAAAGT	176
		Reverse: TGGTCTGGGTTCAGGTTGGA
Egfr	NM_031507	Forward: ACTTCACAATGAGGGTTTCAGG	186
		Reverse: TCCTTGTTAACCAGTCATGCTCA
Ctgf	NM_022266	Forward: AAATAAACTGCCTCCCAAACCA	91
		Reverse: GAAATGGCTTGCTCAGGGTAAC
Okl38	NM_138504	Forward: TGCAGATCTGATGGTGAAAGGT	133
		Reverse: AAGGTGGGAGCAGTAGCCATAG
Fgfr2	XM_341940	Forward: GCCGCCGGTGTTAACACC	145
		Reverse: CTGGCAGAACTGTCAACCA
Tgif1	NM_001015020	Forward: GGAGTTGGGAGGAGAAGATCA	185
		Reverse: TTTGCACATGAGATTGCTCAAA

SDS-polyacrylamide gel electrophoresis and western blotting

Protein from rat jejunum and IEC-6 cells was extracted using a total protein extraction kit (K3011010, Biochain, Hayward, California, USA) and quantified using a BCA protein assay kit (23225, Pierce, Rockford, USA). 30 µg of total protein was loaded and electrophoresced for 40 min at 200 V, before being transferred onto nitrocellulose membranes (88585, Pierce, Rockford, USA). Blots were blocked overnight at 4°C in SuperBlock T20 (TBS) blocking buffer (37536, Pierce, Rockford, USA). Phospho-ERK1/2, ERK1/2 (4376, 4695, CST, MA, USA) and Actin (SC-1615, Santa, USA) antibodies were added to the block buffer at 1:1000 dilutions and incubated for 2 h under agitation. Blots were washed in PBST20 for 5 min with shaking. Goat anti-rabbit IgG-HRP (SC-2004, Santa) and donkey anti-goat IgG-HRP (SC-2033, Santa) secondary antibodies were diluted to 1:500 and incubated for 2 h under agitation. Blots then were washed in PBST20 for 5 min with shaking and visualised using a SuperSignal® West Pico Chem luminescent substrate (34080, Pierce, Rockford, USA). Blots then were exposed to X-ray film (Kodak, USA).

Statistical analysis

All results are presented as mean ± SD. Statistical analysis was performed by independent-sample T-tests using SPSS 12.0 software. A p-value of less than 0.05 was considered to indicate a significant difference. Microarray analysis was conducted using GeneSpring GX_10.0.

Results

In vivo studies

Assessment of heat treatment. Changes in body temperature and serum glucocorticoid levels were used as primary criteria for indicating heat stress in mammals. Therefore, rectal temperature, surface temperature and cortisol concentration were recorded to compare the changes in response to heat treatment. Rat rectal and body surface temperatures were found to be significantly increased after 2 h of heat treatment (Figure 1A and Figure 2). Serum cortisol levels were significantly increased in heat-stressed rats compared with control rats on days 1, 3 and 6; however, no significant difference was found on the 10th day of heat stress (Figures 1B). The significantly elevated body temperature and serum glucocorticoid levels after heat exposure indicate the rats underwent conditions of significant heat stress. There was no significant difference in serum cortisol levels on day 10 after heat treatment revealing the animals had adapted to heat stress.

Figure 1. (A) Rat rectal temperature before and after heat treatment. Rat rectal temperatures were significantly elevated following 2 h heat exposure at 40°C. (B) Cortisol concentrations from the heat-stressed group were significantly higher than those of the control group on day 1, 3 and 6 after heat treatment. Cortisol concentration was greatest on day 3 before returning to levels equal to the control group by day 10. Values represent the mean ± SE, n = 6 rats for each group. *P < 0.05 for the heat-stressed group versus the control group.

Figure 2. Body surface temperature of rats before (A) and after (B) heat stress. Rat body surface temperature was significantly increased after 2 h heat exposure at 40°C. Values represent the mean ± SE, n = 6 rats for each group. *P < 0.05 for the temperature after heat stress versus before heat stress.

Histological changes in the small intestine following heat stress. To investigate histological changes in the small intestine due to heat treatment, sections of duodenum, jejunum and ileum were stained with hematoxylin and eosin, and the histological structure was observed using microscopy. Bleeding in the intestinal villi and desquamation at the tips of the intestinal villi were observed in the small intestine after heat treatment. The desquamation of mucosal epithelial cells exposed the lamina propria, with such damage found to be most severe in the jejunum on day 3 of the experiment (Figure 3). Thus, the samples of jejunum taken on day 3 were used for microarray analysis.

Figure 3. Photomicrographs of hematoxylin and eosin-stained sections of rat jejunum on day 3 (200× magnification). (A) control; (B) heat treatment (on day 3). Severe damage to rat intestinal villi is apparent, with desquamation at the tips of the intestinal villi and the lamina propria is exposed. Abnormal microstructures are indicated with arrowheads. Scale bar represents 100 µm.

Microarray data analysis. To gain insight into the effects of heat stress on gene expression in rat jejunum we performed six rat genome microarrays. Genes known to have a significant role in the defence response and regulate cell growth are listed in Table II. The expression levels of genes related to defence response including Hsps, Abcb11, Herpud1, Bcl2l1, Abcc2, Stip1, Ddit3, Prkab1 and Cryab were all significantly increased after heat exposure. Expression levels of genes related to cell proliferation, differentiation and growth including Gdf15, Gdf9, Pdgfa, Vegfa, Okl38 and Xrn2_ were all up-regulated, while Alb, Bmp2, Casp3, Ccl2, Ccne1, Egfr, Fgfr2, Mmp9, Igfbp3 were all down-regulated. Hierarchical clustering was conducted using GeneSpring GX_10 (Distance metric: Pearson centred; Linkage rule: average linkage) and are listed in Figure 4. To examine gene ontology, including biological processes, cellular components, molecular functions, and genetic networks, the data obtained were analysed using Ingenuity Pathways Analysis tools. We predicted that the interaction of growth-related molecules detected in the current study will provide insight into the possible mechanisms of heat stress-induced cellular damage and regeneration (Figure 5).

Figure 4. Hierarchical clustering of dysregulated genes conducted using GeneSpring GX. Control groups comprise: Control A, Control B and Control C. Heat-stressed groups comprise: SJ G, SJ H, and SJ I. Red and green colours in the heat map represent up-regulation and down-regulation relative to control, respectively.

Figure 5. Gene network map of growth-related molecules including Alb, Egfr, Fgfr2, Tgif, Pdgfa, Vegfa, Gdf-9, Okl18, Ctgf and Gdf-15 by GeneSpring GX_10.0 based on the database.

Table II.  Microarray analysis of the effects of heat stress on cell growth-related gene expression profiles in rat jejunum analysed on day 3 following heat exposure.

Probename Gene response to stress	Log2 ratio	Ttest	Gene symbol	Description	Genbank accession	GO biological process
A_44_P350108	0.879317	0.004903	Abcb11	ATP-binding cassette, sub-family B (MDR/TAP)	NM_031760	Response to oxidative stress; response to drug
A_43_P11580	1.883691	0.007395	Abcc2	ATP-binding cassette, sub-family C (CFTR/MRP), member 2	NM_012833	Response to oxidative stress; response to heat Organic anion transport; homeostasis
A_44_P254238	0.873018	0.002342	Bcl2l1	Bcl2-like 1 (Bcl2l1), transcript variant 3	NM_001033670	Apoptosis; response to oxidative stress Negative regulation of survival gene product activity
A_44_P1047924	1.105177	0.000755	Herpud1	Homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1	NM_053523	Protein modification process; calcium ion homeostasis Response to stress; response to unfolded protein
A_44_P109342	7.46189	1.46E−05	Hspa1a	Heat shock 70kD protein 1A (Hspa1a), mRNA [NM_031971]	NM_031971	Telomere maintenance; DNA repair; protein folding Anti-apoptosis; defence response; response to heat
A_42_P541025	1.780141	0.003346	Hspa1l	Heat shock 70kD protein 1-like (mapped) (Hspa1l)	NM_212546	Protein folding
A_42_P625181	0.459123	0.002354	Hspa4	Heat shock protein 4 (Hspa4)	NM_153629	Response to unfolded protein; response to heat
A_44_P1049055	1.131631	0.00914	Hspa4l_ predicted	PREDICTED: Heat shock 70kDa protein 4-like (predicted) (Hspa4l_predicted)		Protein folding; response to unfolded protein
A_44_P1054213	0.514916	0.005248	Hspa5	Heat shock 70kDa protein 5 (glucose-regulated protein) (Hspa5)	NM_013083	Anti-apoptosis; ER overload response
A_43_P12417	1.830802	9.72E−05	Hspa8	Heat shock protein 8 (Hspa8), mRNA [NM_024351]	NM_024351	Regulation of progression through cell cycle Protein folding; response to unfolded protein Chaperone cofactor-dependent protein folding
A_44_P992908	3.92618	0.002892	Hspb1	Heat shock 27kDa protein 1	NM_031970	Regulation of translational initiation; anti-apoptosis Cell motility Response to unfolded protein
A_44_P134143	1.4521	0.000187	Hspb8	Heat shock 22kDa protein 8	NM_053612	Protein folding
A_44_P299870	2.112075	0.000154	Hspca	Heat shock protein 1, alpha	NM_175761	Protein folding Positive regulation of nitric oxide biosynthetic process
A_44_P116130	1.604813	0.000445	Hspcb	Heat shock 90kDa protein 1	NM_001004082	Protein folding; response to unfolded protein
A_44_P287194	1.297766	0.000329	Hspcb	Heat shock 90kDa protein 1	NM_001004082	Protein folding; response to unfolded protein
A_42_P651962	0.820161	4.9E−05	Hspd1	Heat shock protein 1 (chaperonin)	NM_022229	Response to hypoxia; protein folding Response to unfolded protein; response to heat Response to organic substance
A_43_P11636	0.613808	0.000105	Hspe1	Heat shock 10 kDa protein 1 (chaperonin 10)	NM_012966	Protein folding; caspase activation
A_44_P121374	3.759091	2E−05	Hsph1	Heat shock 105kDa/110kDa protein 1	NM_001011901	Response to unfolded protein Chaperone cofactor-dependent protein folding
A_43_P13337	2.120064	0.003865	Stip1	Stress-induced phosphoprotein 1	NM_138911	Response to stress
A_44_P445344	1.709525	0.000136	Ddit3	DNA-damage inducible transcript 3	NM_024134	Regulation of progression through cell cycle Transcription response to DNA damage stimulus Response to oxidative stress; cell cycle Unfolded protein response
A_44_P531758	1.20065	0.000549	Cryab	Crystallin, alpha B (Cryab)	NM_012935	Protein folding Oxygen and reactive oxygen species metabolic process Response to stress; response to heat
A_44_P1056161	−1.05559	0.002451	Prkab1	Protein kinase, AMP-activated, beta 1 non-catalytic subunit	NM_031976	Response to stress; protein hetero oligomerization
Gene Related to Growth
A_44_P1017367	−2.00334	0.00158	Alb	Albumin	NM_134326	Transport Transforming growth factor beta receptor signalling pathway Cellular response to starvation; response to organic substance
A_44_P1013851	−0.60437	0.000238	Bmp2	Bone morphogenetic protein 2	NM_017178	Osteoblast differentiation; inflammatory response Transforming growth factor beta receptor signalling pathway Negative regulation of cell proliferation; Organ morphogenesismineralization;growth
A_44_P530813	−0.86667	0.008874	Casp3	Caspase 3, apoptosis related cysteine protease	NM_012922	B cell homeostasis Release of cytochrome from mitochondria DNA fragmentation during apoptosis Induction of apoptosis Induction of apoptosis by oxidative stress; response to UV Response to wounding
A_42_P695401	−0.7451	0.008983	Ccl2	Chemokine (C-C motif) ligand 2	NM_031530	Positive regulation of endothelial cell proliferation Protein amino acid phosphorylation Calcium ion homeostasis; anti-apoptosis Transforming growth factor beta receptor signalling pathway; Vascular endothelial growth factor receptor signalling pathway
A_44_P507571	−0.79462	0.003609	Ccne1	G1/S-specific cyclin-E1. [Source: Uniprot/SWISSPROT;Acc:P39949]		Regulation of progression through cell cycle G1/S transition of mitotic cell cycle; cell cycle DNA replication initiation; protein amino acid phosphorylation Cell growth
A_42_P703647	1.290115	0.009738	Cda_predicted	PREDICTED: Cytidine deaminase (predicted) (Cda_predicted)		Cell surface receptor linked signal transduction; Pyrimidine salvage; cytidine deamination; Negative regulation of cell growth
A_42_P484738	−0.572781	0.007223	Ctgf	Connective tissue growth factor	NM_022266	Cartilage condensation; ossification; angiogenesis; regulation of cell growth; DNA replication; cell motility; cell adhesion; cell-matrix adhesion
A_44_P555253	1.834412	0.000447	Dnaja1	DnaJ (Hsp40) homolog, subfamily A	NM_022934	Protein folding; response to unfolded protein; DNA damage response
A_44_P346408	−0.64866	0.004886	Egfr	Epidermal growth factor receptor	NM_031507	Activation of MAPKK activity; cell morphogenesis Ossification; response to stress Epidermal growth factor receptor signalling pathway Cell proliferation activity
A_43_P10225	−0.41388	0.002691	Fgfr2	PREDICTED: Fibroblast growth factor receptor 2	XM_341940	Angiogenesis; cell-cell signalling Positive regulation of cell proliferation Fibroblast growth factor receptor signalling pathway Cell growth; epithelial cell proliferation
A_43_P16529	0.729708	0.002458	Gadd45b	Growth arrest and DNA-damage-inducible 45 beta	NM_001008321	Regulation of progression through cell cycle Activation of MAPK activity; apoptosis Response to stress
A_42_P608780	2.278219	0.000801	Gdf15	Growth differentiation factor 15	NM_019216	Transforming growth factor beta receptor signalling pathway Cell-cell signalling
A_43_P12097	1.413789	0.000663	Gdf9	Growth differentiation factor 9	NM_021672	Transforming growth factor beta receptor signalling pathway
A_42_P627998	−0.57157	0.001065	Igfbp3	Insulin-like growth factor binding protein 3	NM_012588	Regulation of cell growth; positive regulation of apoptosis
A_44_P501112	−1.28625	0.001266	Mmp9	Matrix metallopeptidase 9	NM_031055	Response to oxidative stress; cell growth Positive regulation of apoptosis
A_44_P529581	2.227634	0.007915	Okl38	Pregnancy-induced growth inhibitor	NM_138504	Negative regulation of cell growth
A_44_P322910	0.969926	0.009512	Pdgfa	Platelet derived growth factor, alpha	NM_012801	Regulation cell cycle; angiogenesis Response to hypoxia; cell proliferation Transforming growth factor beta receptor signalling pathway
A_44_P432432	0.825118	0.00612	Plat	Plasminogen activator, tissue	NM_013151	Protein modification process; proteolysis
A_44_P262229	0.818628	0.000619	Ppid	Peptidylprolyl isomerase D (cyclophilin D)	NM_001004279	Protein folding; anti-apoptosis; response to oxidative stress
A_43_P12708	0.637728	0.001747	Src	Rous sarcoma oncogene	NM_031977	Response to acid; response to stress Epidermal growth factor receptor signalling pathway; Intracellular signalling cascade; cell proliferation Apoptosis; positive regulation of cell adhesion Platelet-derived growth factor receptor signalling pathway
A_44_P157222	0.529511	0.004265	Tgif	TG interacting factor	NM_001015020	Multicellular organismal development; negative regulation of cell growth
A_43_P15572	1.016927	0.004957	Vegfa	Vascular endothelial growth factor A	NM_031836	Regulation of progression through cell cycle Angiogenesis; blood vessel development Vasculogenesis; response to hypoxia Anti-apoptosis Positive regulation of vascular endothelial growth factor receptor Signalling pathway
A_44_P1026431	−0.86238	2.89E−05	Xrn2_predicted	PREDICTED: 5'-3' exoribonuclease 2 (predicted)		Cell growth

Note: Genes which expressed were up- or down-regulated at least two-fold. Genes are categorised based on their biological process.

Validation of growth-related molecules mRNA expression. To validate the changes in expression of growth-related genes which had significant variation in cDNA microarray analysis, ten selected genes were confirmed by real-time quantitative RT-PCR and displayed in Figure 6. The one exception to the trend was Tgif RNA expression, which may have been due to the poor specificity of the Tgif probe in the microarray. The change in gene expression levels of most genes was found to be closely correlated with the corresponding microarray data, although the exact fold change differed between the two assays.

Figure 6. Relative mRNA expression of growth-related molecules in rat jejunum. Analysis was performed using microarray and real-time PCR. Values represent the mean ± SE, n = 6 rats for each group. *P < 0.05 for the heat-stressed group versus the control group.

In vitro experiment

Cell viability, morphology and apoptosis due to heat treatment. IEC-6 cells were subjected to 42°C, based on our previous study. The growth-inhibitory effect of heat treatment was measured using the MTT assay. Cellular proliferation and viability were significantly reduced after exposure to 42°C for 3 h, 4 h, and 5 h but not 2 h (Figure 7A), therefore, 3 h of exposure to 42°C was chosen as the treatment for IEC-6 cells in the following experiments. Following heat exposure, IEC-6 cells were examined under the phase-contrast inverted microscope. The morphology was markedly altered, differing in cell shape, and a greater dead cell mass was clearly observed in the supernatant (Figure 7B). To detect and measure apoptosis, IEC-6 cells were stained with annexin V/propidium iodide (PI) and submitted to FACS analysis. Apoptosis significantly increased after heat stress, which was exacerbated with the presence of U0126 in rat IEC-6 cells (Figure 7C). The results indicated that heat treatment reduced cell viability, caused cell damage and induced apoptosis, ERK1/2 inhibition exacerbated cell damage and apoptosis in the heat stress group.

Figure 7. (A) Cell proliferation and viability were measured by MTT analysis after IEC-6 cells were submitted to 42°C for 2, 3, 4 and 5 h respectively. Compared with the control group, cell proliferation and viability were significantly reduced following heat stress for 3, 4, and 5 h, but no significant difference for 2 h. (B) Photomicrographs of IEC-6 cells demonstrate gross cell morphology (200× magnification). a: control, b: heat stress (42°C for 3 h), c: U0126 (20 µmol/L) combined with heat stress (42°C for 3 h) d: U0126 (20 µmol/L) without heat stress. (C) Cell apoptosis analysis displaying control, and heat stressed cells (42°C for 3 h) with or without U0126 (20 µmol/L), after treatment all attached cells were collected and stained with annexin V/propidium iodide for apoptosis analysis. Cell apoptosis was significantly increased after heat stress and could be augmented by the addition of U0126.

Growth-related molecules mRNA expression. mRNA expression levels of growth-related molecules in control and heat stressed rat IEC-6 cells were evaluated using real time PCR. The results indicated that Fgfr2, Tgif, Pdgfa, Vegfa, Gdf15, Okl38 and Gdf9 were all significantly up-regulated, while Alb, Egfr and Ctgf were significantly down-regulated after heat exposure. To investigate whether ERK1/2 inhibition influence on growth-related molecule mRNA expression during heat stress, IEC-6 cells were subjected to heat combined with U0126. There was a further up- or down-regulation of Egfr, Ctgf, Tgif, Vegfa, Okl38 and Gdf15 in response to heat stress with the addition of U0126 (Figure 8), indicating ERK1/2 signalling can modulate growth-related molecule mRNA expression during heat stress.

Figure 8. Relative mRNA expression of growth factors in rat IEC-6 cells analysed by real-time PCR. Group protocols included: control, (cultivated in 37°C) heat stress (exposure to 42°C for 3 h), U0126 (20 µmol/L)+heat treatment. Values represent the mean ± SE, n = 6 for each group. *P < 0.05 for the heat-stressed group versus the control group.

Activation of the ERK1/2 signaling pathway in rat jejunum and IEC-6 cells due to heat treatment. To investigate whether ERK1/2 was activated after heat treatment both in vivo and in vitro, ERK1/2 phosphorylation in rat jejunum and IEC-6 cells was measured by western blot analysis. Heat treatment was found to significantly increase phosphorylation of ERK1/2, reversible by the addition of U0126 (Figure 9).

Figure 9. ERK1/2 phosphorylation in rat jejunum and IEC-6 cells was determined using western blotting. Cells underwent the following protocols: control, cultivated in 37°C; heat stress, temperature elevated to 42°C for 3 h; inhibition group, application of U0126 combined with heat stress (42°C for 3 h). Heat stress significantly induced ERK1/2 phosphorylation, which was abolished when U0126 was applied. Values represent the mean ± SE, n = 6 for each group. *P < 0.05 for the heat-stressed group versus the control group, *P < 0.05 for the U0126 group versus the heat-stressed group.

Discussion

Heat stress caused damage to rat intestine and IEC-6 cells

The small intestine plays a critical role both in providing a barrier to pathogens and an absorptive function [1]. However, many stressors such as radiation, lipopolysaccharides (LPS), pharmacological drugs, endotoxins and heat can cause damage to the intestinal epithelium [2]. Focusing on heat stress, when mammals are exposed to environmental temperatures greater than their thermoneutral temperature internal body heat is dissipated by increased peripheral blood flow which, in turn, dramatically reduces blood flow to the GI tract [4], [13]. The ischaemia and hypoxia experienced by the small intestine can result in necrosis and shedding of epithelial cells of the intestinal villi. Intestinal epithelial cell damage may disrupt the intestinal barrier and reduce absorptive function. In the present study, we found obvious damage in rat small intestine, and such damage was most severe in the jejunum within three days of initiation of treatment (40°C, RH 60% for 2 h), consistent with our previous studies [6], [7]. Furthermore, we employed a rat intestinal epithelial cell line (IEC-6) to analyse cell morphology, viability, apoptosis, growth-related molecule mRNA expression, as well as ERK1/2 signalling in response to heat stress in vitro. The effect of heat stress on IEC-6 cells was previously found to be dependent on temperature and duration of heat treatment. Based on previous experiments subjecting IEC-6 cells to between 40°C and 43°C for 2 to 5 h, a heat treatment protocol of 42°C for 3 h was chosen for the current in vitro study. Clear morphological changes were present in IEC-6 cells after heat treatment, supporting previous reports of cell damage following several different stressors [14].

The MTT assay and FACS analysis determined that heat treatment caused a significant reduction in cell viability and induced apoptosis in cultured IEC-6 cells. Cells possess the capability to self-induce programmed cell death (apoptosis) in response to environment and physical stress [15–17]. Oxidative stress, hyperthermia, and irradiation-induced apoptosis have been observed in many different types of cells [18–20]. The ratio of apoptotic to healthy cells was found to be significantly increased during the early period of heat stress compared with control (11.9% versus 3.6%, respectively). More interesting, addition of a specific ERK1/2 inhibitor (U0126) augmented heat stress-induced apoptosis to 85% of total cells, indicating ERK1/2 activation may be vital for cellular survival during heat stress.

Heat stress affected growth factor mRNA expression and induced ERK1/2 activation

Heat stress results in a complex cellular response including alterations in gene expression and biochemical adaptations. It is now widely accepted that changes in gene expression are an integral part of the cellular response to heat stress [21–23]. In the present study, mRNA expression of the genes associated with the stress and defence response, as well as cellular growth and proliferation, were significantly altered after heat stress both in vivo (in the rat jejunum) and in vitro (in rat IEC-6 cells). Growth-related molecules (including Alb, Egfr, Ctgf, Fgfr2, Pdgfa, Tgif, Vegfa, Gdf15 and Gdf9) are a group of biologically active polypeptides which function as hormone-like regulatory signalling molecules, controlling cell survival, growth, differentiation, adhesion, migration, tumour angiogenesis, wound healing and tissue repair [24]. Growth-related molecules are also reported to regulate and activate cellular mitogenic and stress-associated signalling transduction pathways, leading to changes in gene expression controlling various cellular functions [9], [25]. For example, The epidermal growth factor receptor (EGFR) is strongly associated with healing of damaged gastric mucosa, repairing and regenerating the protective tissue [26], activated by a variety of non-specific stimuli such as ionising radiation, UV-radiation, hypoxia and oxidative stress [27], [28]. In the present study, Egfr mRNA expression was down-regulated, both in vivo and in vitro, supporting our previous findings in heat-stressed pig jejunum [6]. Both GDF-9 and GDF-15 are novel members of the TGF-β superfamily associated with cell proliferation, differentiation, extracellular matrix formation, and immune defence [29], [30]. Recently, GDF-15 has been reported to provide cardioprotection following ischaemia/reperfusion injury [31]. In the current study, both GDF-9 and GDF-15 were found to be up-regulated after heat treatment, indicating they may play an important role in heat stress. Moreover, comparing the growth-related gene expression between in vivo (jejunum) and in vitro (IEC-6 cells) experiments after heat treatment; the expression patterns of Alb, Egfr, Ctgf, Pdgfa, Tgif, Vegfa, Gdf9 and Gdf15 correlated significantly, but the expression patterns of Fgfr2 and Tgif did not. The jejunum contains many distinct types of cells and, although the IEC-6 cell line is commonly used as a model to elucidate the mechanisms underlying intestinal epithelial cell differentiation, growth, and wound healing, some differences were apparent in gene expression in response to heat stress between the jejunum and IEC-6 cells.

The extracellular-regulated kinases MAPK p42 and p44 (ERK1/2) are from the family of classical mitogen-activated protein kinases (MAPK) which respond to extracellular stimuli and regulate various intracellular processes including gene expression, mitosis, cell differentiation, cell proliferation, cell survival and apoptosis. ERK1/2 can be activated by various stimuli including cytokines, irradiation, heat stress, and osmotic stress. Activated ERK1/2 then, in turn, phosphorylate a diverse array of their substrate proteins [10], [19]. In the present study, phosphorylation of EK1/2 was significantly increased following heat exposure both in vivo and in vitro, indicating the ERK1/2 signalling pathway to be activated in response to heat stress.

Inhibition of ERK1/2 phosphorylation augmented heat stress-induced cell apoptosis and altered growth factor mRNA expression

Activation of ERK1/2 can result in both protective and detrimental effects to the cell [32]. For example, ERK1/2 activation protects cells from a variety of cytotoxic insults, including death receptor activation, growth factor withdrawal, DNA damage, oxidative stress and hypoxia. However, several recent studies have suggested that ERK1/2 activation is implicated in apoptotic cell death induced by glutamate, reactive oxygen, and reactive nitrogen species in several types of cells [33–36]. Therefore, ERK1/2 activation may stimulate different biological outcomes dependent on cell type and the specific stimulus. To further investigate whether ERK1/2 activation was involved in cell damage and apoptosis during heat stress, we observed the effect of administering U0126 (a selective MEK kinase inhibitor) during heat stress. Western blot analysis revealed that heat-stress induced phosphorylation of ERK1/2 was abolished by U0126. In turn, inhibition of ERK1/2 phosphorylation exacerbated cell damage and dramatically elevated cell apoptosis (85%, determined by FACS assay) in heat stress, indicating ERK1/2 activation may play a role in cell survival in rat IEC-6 cells during heat stress, but further studies are required. Inhibiting ERK1/2 also altered several growth-related molecules’ mRNA expression in IEC-6 cells after heat exposure; we speculated that ERK1/2 signalling may provide a critical regenerative role where heat stress-induced damage has occurred through activating regulated cellular growth, proliferation and cellular differentiation.

In conclusion, we revealed heat stress caused obvious damage to rat intestines and IEC-6 cells, reduced cell growth and proliferation viability, induced cell apoptosis, altered growth-related molecule mRNA expression and elevated ERK1/2 phosphorylation. ERK1/2 inhibition exacerbated apoptosis and affected growth factor mRNA expression in heat stress. Further work investigating these genes at the protein level is essential in order to determine whether the altered gene expression is related to changes in the level of proteins, and in their activity or signal pathways.

Acknowledgements

We are thankful for the help from the members of CAU-BUA TCVM teaching and research team.

Declaration of interest: This work was supported by grants from the National Natural Science Foundation of China (No.30771566), Learning Innovative Group Programs of Beijing Education Committee, Beijing Natural Science Foundation (No.6082007) and the National Eleventh Five-Year Scientific and Technological Support Plan (No. 2008BADB4B01, 2008BADB4B07).