Emodin induces cytotoxic effect in human breast carcinoma MCF-7 cell through modulating the expression of apoptosis-related genes

Abstract

Context: The poor prognostic outcome of breast cancer is largely due to its resistance to cancer therapies. Development of therapeutic agents that can inhibit growth and induce apoptosis in breast cancer cells can help solve the problem. Emodin is an active anthraquinone that has been reported to have diverse biological effects.

Objective: In this study, the anticancer effects of emodin on growth inhibition, apoptosis induction and the expression of apoptosis-related genes in MCF-7 cells were investigated.

Materials and methods: Growth inhibition induced by emodin was investigated by the MTS assay and the colony formation assay; while emodin-induced apoptosis was determined by the COMET assay and DNA fragmentation detection. Emodin (35 μM)-induced alterations in the expression of apoptotic-related genes were detected by using real-time PCR.

Results: Emodin had significant growth inhibitory effects on MCF-7 cells with IC₅₀ = 7.22 µg/ml (∼30 μM). It also exerted a concentration-dependant inhibitory effect on the colony-forming ability of MCF-7 cells with IC₅₀ = 7.60 µg/ml (∼30 µM). Hallmarks of apoptosis, such as single-strand DNA breakage and DNA fragmentation, were observed in emodin-treated MCF-7 cells. The gene expression of Fas ligand (FASL) was up-regulated (p < 0.01) but those of MCL1, CCND1 and C-MYC were down-regulated (p < 0.05) in emodin-treated MCF-7 cells.

Discussion and conclusion: This study indicated that emodin could induce growth inhibition and apoptosis in MCF-7 cells through the modulation of the expression of apoptosis-related genes. The growth inhibitory effects of emodin might involve both the intrinsic and the extrinsic apoptotic pathways and cell cycle arrest.

• Anthraquinone
• cell cycle arrest
• growth inhibition
• programmed cell death

Introduction

Breast cancer is the most common and lethal malignancy among women worldwide (Kummalue et al., 2007). The poor prognostic outcome of breast cancer is largely due to its resistance to current cancer therapies. Current approaches for treating human breast cancer include surgery, radiotherapy, hyperthermia, hormone replacement therapy and adjuvant chemotherapy. However, the effects of these conventional treatments are not always satisfactory. Therefore, recent research focus on breast cancer management is the development of better therapeutic agents that can inhibit growth and induce apoptosis in cancer cells. This is because the inhibition of cancer cell growth and the induction of cancer cell death are the two major therapeutic parameters in cancer treatment.

Emodin (1,3,8-trihydroxy-6-methylanthraquinone) is a biologically active anthraquinone derivative that naturally occurs in many widely used Chinese medicinal herbs, such as Rheum officinale Baill (Polygonaceae). A water extract of R. officinale has been shown by our laboratory to have anticancer effects on MCF-7 cells (Li et al., 2009). Many previous reports have indicated that emodin possesses diverse biological effects, such as antibacterial, diuretic, immunosuppressive, anti-inflammatory and vasorelaxant activities (Basu et al., 2005; Huang et al., 1991a,b; Kim et al., 2005; Li et al., 2005; Zhang et al., 2005). Emodin has also been reported to have anti-proliferative effects on several human cancer cell lines (Chen et al., 2002; Huang et al., 2004, 2008; Lee, 2001; Lee et al., 2001; Srinivas et al., 2003) through different molecular mechanisms. However, the anti-proliferative effect of emodin on MCF-7 cells and the anticancer mechanisms involved have not been clearly demonstrated.

Apoptosis refers to programmed cell death, a common physiological process, to remove unwanted or dying cells from the body. Apoptosis can be induced either by the intrinsic pathway which is initiated by mitochondria or by activating the death receptor (extrinsic) and it may provide the mechanistic basis for the anticancer effects of emodin on MCF-7 cells. Cell shrinkage and mono- or oligo-chromosomal DNA breakage are some of the characteristics of apoptosis. Any modulation on the expressions of apoptosis-related genes could also trigger apoptosis. In recent years, many reports have revealed that modulating the expression level of apoptosis-related genes, such as Fas ligand (FASL), myeloid cell leukemia sequence 1 (MCL1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), BCL2-associated X protein (BAX), cyclin D1 (CCND1) and v-myc myelocytomatosis viral oncogene homolog (C-MYC), provides therapeutic and chemoprevention targets for the treatment of cancer through the induction of cell cycle arrest and apoptosis (Ahn et al., 2006; Chang et al., 2004; Ishitani et al., 2003; Jang et al., 2004; Lee et al., 2005; Lin et al., 2005; Petty et al., 2003; Way et al., 2005; Wu et al., 2005; Zhang & Huang, 2006).

In this study, we examined the anticancer effects of emodin on cell growth inhibition, colony formation inhibition, apoptosis induction (DNA fragmentation detection and COMET assays), and the expression of apoptosis-related genes in MCF-7 cells. The results indicate that emodin could significantly inhibit cell growth and colony formation and induce apoptosis in MCF-7 cells through modulation of the expression of apoptosis-related genes.

Materials and methods

Chemicals and materials

The cell titer 96 aqueous MTS reagent was purchased from Promega Chemicals Co. (Madison, WI). All other chemicals used were of analytical grade. Cell culture medium, Dulbecco’s modified eagle medium (DMEM) and fetal bovine serum (FBS) were purchased from Gibco Laboratories (Grand Island, NY). The human breast carcinoma MCF-7 cell line (HTB-22) was purchased from the American Type Culture Collection (Manassas, VA). Emodin (purity > 98%, HPLC grade) was purchased from Sigma-Aldrich (St. Louis, MO). Emodin was dissolved in DMEM with 0.1% DMSO and stored at −20 °C until use.

Cell culture

MCF-7, the human breast carcinoma cell line, was maintained in low-glucose DMEM supplemented with 10% (v/v) FBS, 100 units/mL penicillin and 100 µg/mL streptomycin (Sigma, St. Louis, MO) in a culture plate at 37 °C in a humidified incubator with 5% carbon dioxide. The media of the cells were changed every 2–3 d and the cells were sub-cultured once they reached 70–80% confluence.

MTS assay

The inhibitory effects of emodin on cell growth were measured by MTS [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium] growth inhibition assay, which is a non-radioactive cell proliferation assay and a colorimetric method for determining the number of viable cells. The MTS growth inhibition assay was performed according to the instructions provided by the manufacturer (Promega). Briefly, 3000 cells were seeded into each well of a 96-well plate (Falcon) on day 1. On day 2, the cells were either treated with different concentrations of emodin for different incubation periods (24, 48 or 72 h) or remained as untreated controls at 37 °C with 5% carbon dioxide. At the end of each time point, fresh complete medium containing 10 µL of MTS solution was added and further incubation for 2 h was carried out. The optical density of each culture was subsequently recorded at 490 nm using a microplate reader (Bio-Rad, model 550, Hercules, CA). Each experiment was performed in triplicate. Results are expressed as the percentage of growth inhibition with respect to the untreated cells (control).

Soft agar colony formation assay

Soft agar colony formation assays were performed using a double-layer soft-agar method. In each well of a 6-well plate, 20 000 cells were mixed with different concentrations of emodin and plated in top agar (0.5% agarose) over a base agar of 0.6% agarose. Cells were incubated for 7 to 14 d under standard conditions. Colonies with more than 50 cells were counted.

COMET assay (single-cell gel electrophoresis)

Drug-induced DNA damage was analyzed using the COMET assay (Klaude et al., 1996; Singh et al., 1988) with slight modifications. Cell pellets (treated with various concentration of emodin for 72 h) were collected by centrifugation and re-suspended with 200 µL of phosphate-buffered saline (PBS) and 800 µL of 1% low-melting point (LMP) agarose. The mixture was subsequently pipetted onto frosted glass microscope slide pre-coated with a layer of 1.0% normal melting point agarose prepared in PBS. The LMP agarose covered with a cover slip and incubated at 4 °C for 10 min. After the solidification of LMP agarose, the cover slips were gently removed and replaced with another 0.8% LMP agarose pre-coated cover slip with its 0.8% LMP agarose facing the solidified LMP agarose, and allowed to solidify at 4 °C for 10 min. After 10 min, the cover slip was removed and the cells were lysed in high salt solution (2.5 M NaCl, 10 mM Tris-HCl, 100 mM EDTA, pH 10, with 1% Triton and 10% dimethyl sulfoxide) for 1 h. The slide was then placed in a horizontal electrophoresis unit with fresh buffer (1 mM EDTA, 300 mM NaOH, pH 13) and incubated for 20 min to allow unwinding of DNA. Electrophoresis was then conducted in freshly prepared electrophoresis buffer (pH 13) for 20 min at 25 V and 300 mA (0.8 V/cm) at 4 °C. Subsequently, the slides were gently washed with neutralization solution (0.4 M Tris-HCl, pH 7.5) for 20 min and stained with 20 µL ethidium bromide (15 µg/mL). Stained nucleoids were scored visually using a fluorescence microscope (Leica, Wetzlar, Germany) equipped with a digital camera. One hundred comets on two slides were acquired using the IM50 software image analysis system (Leica, Wetzlar, Germany). Tail length was calculated and expressed as means ± SEM.

DNA fragmentation detection assay

Cell pellets (treated with 0 or 35 µM of emodin after 72 h) were lysed with 600 µL nuclear lysis buffer (10 mM Tris-HCl pH 7.5, 400 mM NaCl, 100 mM EDTA, 0.6% SDS) and 10 µL RNase (4 mg/mL) and incubated in water bath at 37 °C for 5 min. After gentle mixing, 200 µL of protein precipitation solution (6 M NaCl) was added and chilled on ice for 5 min. Next, the mixture was centrifuged at 17 779 g for 10 min (at room temperature), and the supernatant was collected. The supernatant was subsequently mixed with 600 µL isopropanol and chilled on ice for 15 min. Next, this mixture was centrifuged at 17 779 g for 20 min, and the pellet was washed with 600 µL of 70% ethanol. The DNA pellet was air dried and re-suspended in 200 µL of Tris-EDTA buffer [10 mM Tris-HCl (pH 8.0) and 1 mM EDTA], and the concentration of DNA was determined spectroscopically. DNA (10 µg/µL) was electrophoresed on 1.5% agarose gel with ethidium bromide at 100 V for 2 h and analyzed. The fragmentized inter-nucleosomal DNA was visualized using a UV transilluminator.

Assessment of mRNA expression levels in apoptosis-related genes by real-time PCR

To determine the gene expression levels of Fas ligand (FASL), myeloid cell leukemia sequence 1 (MCL1), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), BCL2-associated X protein (BAX), cyclin D1 (CCND1) and v-myc myelocytomatosis viral oncogene homolog (C-MYC), untreated or emodin (35 µM)-treated MCF-7 cells were trypsinized, and the total RNA was extracted by TRIzol reagent (Molecular Research Center, Inc., Cincinnati, OH). Next, the RNA was reverse transcribed into cDNA by real-time (RT-PCR) (MBI Fermentas) using the SuperScript First-Strand synthesis system (Invitrogen, Life Technologies Inc., Gaithersburg, MD). RT-PCR was performed with a SYBR Green real-time detection kit (Roche Diagnostics, Sydney, Australia) using the Cepheid SmartCycler (Sunnyvale, CA). Total reaction mixture (25 µL) containing cDNA, iQ SYBR Green Supermix, 10 µm forward primer and reverse primer (Table 1), and sterile milli-Q water was prepared. The SYBR Green Supermix (Invitrogen) contained dNTPs (0.4 mM of each), Taq polymerase (50 units/mL), MgCl₂ (6 mM), KCl (100 mM) and Tris-HCl at pH 8.4 (40 mM). Expression levels of cDNA were compared to the internal standard ribosomal protein S9 (RPS9), a housekeeping gene, to correct for differences in the RNA quantity of the samples used. RT-PCR reaction procedures were as follows: 50 °C for 2 min (UDG incubation), 95 °C for 3 min (UDG inactivation and DNA polymerase activation), 40 PCR cycles (except FASL with 50 PCR cycles) consisting of denaturation for 10 s at 95 °C, annealing and extension for 30 s (at 60 °C for RPS9, GAPDH, BAX, CCND1; at 62 °C for MCL1 at 65.7 °C for FASL and 67 °C for C-MYC) and primer extension at 72 °C for 30 s. The internal melting curves of the final PCR products were analyzed from 60 °C to 95 °C. The mRNA expression level of interest was related to the internal standard, and RPS9 was used to correct the differences between the quantity and quality of different samples of RNA. The threshold cycle for each amplification cycle was found and plotted against the standard curve to calculate the concentration of gene product. Values from each group were normalized to the RPS9 gene product. A standard curve assessing the level of DNA was generated for each gene. Each RT-PCR reaction was performed in triplicate.

Table 1. Names and accession number of genes. Forward and reverse primer sequence and product size of genes.

Gene	Gene full name	Forward primer and reverse primer (5′ → 3′)	Product size (bp)	Accession number
RPS9	Ribosomal protein S9	CGTCTCGACCAAGAGCTGA GGTCCTTCTCATCAAGCGTC	114	NM_001013
FASL	Fas ligand	CATTTAACAGGCAAGTCCAACTC TGATCAGCACTGGTAAGATTGAA	326	NM_000639
MCL1	Myeloid cell leukemia sequence 1	CACGAGACGGTCTTCCAAGGCATGCT CTAGGTTGCTAGGGTGCAACTCTAGGA	496	BC017197
GAPDH	Glyceraldehyde-3-phosphate dehydrogenase	GGTCGGAGTCAACGGTTTGG ACCACCCTGTTGCTGTAGCCA	1000	NM_002046
BAX	BCL2-associated X protein	TGGAGCTGCAGAGGATGATTG GAAGTTGCCGTCAGAAACATG	117	NM_004324
CCND1	Cyclin D1	TCTAAGATGAAGGAGACCATC GCGGTAGTAGGACAGGAAGTTGTTG	385	NM_053056
C-MYC	V-myc myelocytomatosis viral oncogene homolog	GATTCTCTGCTCTCCTCGACGGAG GCGCTGCGTAGTTGTGCTGATGTG	274	NM_002467

Statistical analysis

All data are presented as means ± standard errors of mean (SEM). Statistical analysis was performed by analysis of variance (ANOVA) to detect significant differences in multiple comparisons with the Bonferroni post hoc test and comparing all pairs of columns. A value of probability (p) < 0.05 was considered to be statistically significant. All statistical analyses were performed using GraphPad Prism 4.02 software for Windows (GraphPad Software, San Diego, CA).

Results

Inhibitory effect on cell growth

To test the growth inhibitory effects of emodin on MCF-7 cells and to estimate the IC₅₀ values, additional concentration points (0, 5, 10, 15, 20, 25, 30 and 35 µg/mL) were used. MCF-7 cells treated with emodin showed significant growth inhibitory effects after 72 h of treatment with the IC₅₀ value equal to 7.22 µg/mL (∼30 µM; Figure 1). To investigate whether the cytotoxic effect of emodin is time- and concentration-dependent, MCF-7 cells were treated with different concentrations (0, 5, 15 and 35 µg/mL) of emodin for 24, 48 and 72 h. The data indicate that the growth inhibitory effects of emodin on MCF-7 cells are both time- and concentration-dependent (Figure 2).

Figure 1. Growth inhibitory effect of emodin on MCF-7 cells after the 72-h treatment. Data are expressed as means ± SEM, n = 3.

Figure 2. Growth inhibitory effect of emodin (0, 5, 15, 25 and 35 µg/mL) on MCF-7 cells after 24, 48 and 72 h treatments. Data are expressed as means ± SEM, n = 3. **p < 0.01 and ***p < 0.001 represent significant differences when compared with their corresponding control group (emodin, 0 µg/mL).

Inhibition on colony formation

A narrower concentration range with a finer scale (0, 5, 10, 15, 20 and 25 µg/mL) was subsequently used to determine differences in the sensitivity of the colony formation assay. As shown in Figure 3, emodin treatment was found to exert a concentration-dependant inhibitory effect on the colony-forming ability of MCF-7 cells with IC₅₀ values equal to 7.60 µg/mL (∼30 µM).

Figure 3. Inhibitory effect of emodin on the formation of colony of MCF-7 cells after the 10-d treatment. Data are expressed as means ± SEM, n = 3.

Induction of single-strand DNA damage

The COMET assay was performed to study DNA damage in the emodin-treated MCF-7 cells after undergoing the 72-h treatment. The COMET assay is a sensitive method for monitoring single strand (ss) DNA breaks at the single-cell level. Any DNA damage is represented as an increase in the tail length (tail migration) of the DNA strand. When MCF-7 cells were treated with 0, 5, 15, 25 or 35 µg/mL of emodin for 72 h, ssDNA damage was significant, as indicated by the increased tail length observed in the emodin-treated cells compared with the controls (Figure 4). Moreover, the DNA damage induced by the emodin treatment was dose-dependent.

Figure 4. Effect of emodin (0, 5, 15, 25 and 35 µg/mL) on DNA damage in MCF-7 cells after the 72-h treatment represented as comet tail length (µm). Data are expressed as mean ± SEM, n = 100. **p < 0.01 and ***p < 0.001 represent significant differences when compared with the control group.

Induction of chromosomal DNA fragmentation

The IC₅₀ value (30 µM) obtained from a cell inhibition assay was used to validate the emodin-induced apoptotic responses in MCF-7 cells. Chromosomal DNA from untreated and emodin-treated (30 µM) MCF-7 cells was isolated, extracted, and resolved using agarose gel electrophoresis. The gel was analyzed under a UV transilluminator to detect the presence of any fragmented DNA. Emodin treatment resulted in inter-nucleosomal DNA cleavage in MCF-7 cells as indicated by DNA laddering, while the inter-nucleosomal DNA from untreated cancer cells remained intact (Figure 5).

Figure 5. Chromosomal DNA of emodin-treated or -untreated MCF-7 cells following electrophoresis through a 1.5% agarose gel under UV illuminator. Lane 1: 100 bp DNA Marker; lane 2: DNA from 0.05% DMSO-treated MCF-7 cells; lane 3: DNA from 0.05% DMSO and 30 µM emodin-treated MCF-7 cells. All MCF-7 cells were treated with emodin for 72 h.

Modulation of mRNA levels of apoptosis-related genes

To further investigate the apoptotic effects of emodin on MCF-7 cells after emodin (30 µM, the IC₅₀ value) treatment for 72 h, the mRNA levels of apoptosis-related genes, namely FASL, MCL1, GAPDH, BAX, CCND1 and C-MYC, were analyzed. By comparing the mRNA levels of the genes between the control and the emodin-treated samples, the effect of emodin on the gene expression of the apoptosis-related genes could be examined. All the mRNA levels of genes were normalized to that of the internal standard RPS9.

As shown in Figure 6, the 72-h emodin treatment could significantly up-regulate the gene expression of FASL (p < 0.01) and significantly down-regulate the expression of MCL1 (p < 0.05), CCND1 (p < 0.05) and C-MYC (p < 0.01) as compared with those of the control. However, there were no significant changes in the gene expression of GAPDH and BAX (both p > 0.05) in MCF-7 cells after the 72-h emodin treatment.

Figure 6. RT-PCR analysis of the gene expression of FASL, MCL1, GAPDH, BAX, CCND1 and C-MYC on MCF-7 cells after the 72-h treatment with emodin (0 or 30 µg/mL). The expression level of each gene was normalized to that of the RPS9 gene. Data are expressed as means ± SEM, n = 3. *p < 0.05 and **p < 0.01 represent significant differences when compared with the control.

Discussion

In this study, the in vitro anticancer effect of emodin on the human breast carcinoma MCF-7 cells was investigated by monitoring the cell growth, colony formation, changes of chromosomal DNA, and mRNA levels of apoptosis-related genes in emodin-treated cancer cells. This study confirmed that emodin has strong dose- and time-dependent anticancer activities against MCF-7 cells (Figure 2) with an IC₅₀ equal to 7.22 µg/mL (∼30 µM; Figure 1). This finding suggests that emodin functions by inhibiting the growth of tumor cells. In fact, inhibition of the growth of tumor cells is one of the major benchmark of successful cancer treatment. Emodin also inhibits the colony growth potential of MCF-7 cells in a dose-dependent manner (Figure 4). This result suggests that emodin could inhibit the anchorage-independent growth of MCF-7 cells.

Apoptosis and necrosis are two types of cell death. In this study, the emodin-treated MCF-7 cells showed cell shrinkage (data not shown), DNA single-strand breakage at the single-cell level (Figure 5), and chromosomal DNA fragmentation (Figure 6), which are morphological hallmarks of apoptosis. These findings suggest that emodin could activate the activity of the DNA endonuclease on double-strand cleavage of chromosomal DNA into fragments. Similar observations have been reported in emodin-treated human lung squamous cell carcinoma CH2 (Lee, 2001; Lee et al., 2001), the human hepatoma cell lines HepG2 and C3A (Shieh et al., 2004), human promyeloleukemic HL-60 cells (Chen et al., 2002), human cervical cancer Bu 25TK cells (Srinivas et al., 2003), and human cancer HSC5 and MDA-MB-231 cells (Huang et al., 2004).

In fact, apoptosis can be triggered by a variety of physiological and stress stimuli that initiate changes in gene regulation through one or more distinct signaling pathways (Ishitani et al., 2003; Zhan et al., 1994). These stimuli may modulate the gene expression that activates various signaling pathways in apoptosis (Cameron & Feuer, 2001). In this study, the mRNA expression levels of genes that are involved in apoptosis, namely, FASL, MCL1, GAPDH, BAX, CCND1 and C-MYC, were investigated. All gene expressions were normalized to the reference gene RPS9.

The current study demonstrated that the mRNA level of FASL was significantly elevated in MCF-7 cells (Figure 6) after treatment of emodin for 72 h. FASL is the gene that encodes the Fas ligand (CD95 ligand). Fas ligand is a membrane glycoprotein that belongs to the tumor necrosis factor family (TNF family) and is involved in the extrinsic pathways of apoptosis. The up-regulation of FASL gene expression enhanced apoptosis through the extrinsic pathways which in turn causes internucleosomal DNA fragmentation and other structural alternations (Cameron & Feuer, 2001). The up-regulation of FASL in emodin-treated cells implies that emodin could inhibit the growth of MCF-7 cells through the Fas-mediated apoptotic pathway. Similar observations have been reported in emodin-treated human hepatoma cells (Shieh et al., 2004).

Mcl-1 and Bax belong to the Bcl-2 family of proteins. Mcl-1 refers to myeloid cell leukemia sequence 1 that plays a key role in the regulation of cell death with particular members, such as Bcl-2, and serves as an anti-apoptotic activator that inhibits apoptosis through blocking cytochrome c release from the mitochondria in an intrinsic pathway. The down-regulation of MCL1 gene expression leads to apoptosis. The BAX gene encodes the Bcl-2-associated X protein that forms a heterodimer with Bcl-2. Bax functions as an apoptosis activator and regulates apoptosis in the intrinsic pathway. Up-regulation of BAX gene expression results in apoptosis. In the present study, emodin induced the down-regulation of MCL1 expression but did not change the gene expression of BAX in MCF-7 cells after treatment for 72 h (Figure 6). These data suggested that the apoptotic effect of emodin is through the down-regulation of MCL1 expression but not the up-regulation of BAX expression. In the MCL1 pathway, cytochrome c released from the mitochondria in an intrinsic pathway was promoted. This activity results in the formation of a complex in the cytoplasm that activates caspase-9 and forms an apoptosome. The apoptosome then activates caspase-3, which in turn activates the caspase cascade and results in degradation (Burlacu, 2003; Gross et al., 1999; Link & Harrison, 2001). In the literature, there is no uniform effect of emodin treatment on BAX expression. Some studies showed that there was an up-regulation in BAX expression in emodin-treated cells (Lee, 2001; Lee et al., 2001; Su et al., 2005); while others reported that BAX gene expression remained unchanged in emodin-treated human promyeloleukemic HL-60 cells (Chen et al., 2002). Further studies are warranted to explain the discrepancy.

GAPDH is a gene that encodes glyceraldehyde-3-phosphate dehydrogenase, a key enzyme, and catalyzes an important energy-yielding step in glycolysis, the reversible oxidative phosphorylation of glyceraldehyde-3-phosphate in the presence of inorganic phosphate and nicotinamide adenine dinucleotide. GAPDH is an abundant RNA species; therefore, it is often used as a potential internal RNA standard or housekeeping gene. However, it has been reported that a wide variation in GAPDH expression was observed in different tissues, such as insulin-, dexamethasone- and mitogen-treated cells, virally transformed or oncogene-transfected fibroblasts, and human pancreatic or colon adenocarcinomas (Mogal & Abdulkadir, 2006). In addition, recent advances suggest that GAPDH exhibits diverse non-glycolytic functions depending on its subcellular localization. One of the most intriguing possible functions is the induction of apoptosis. Over-expression of GAPDH was reported to induce apoptosis through the initiation of one or more apoptotic cascades (Ishitani et al., 2003). In the current study, however, emodin treatment brought no significant changes in GAPDH expression in MCF-7 cells (Figure 6), suggesting that emodin-induced apoptosis is GAPDH-independent.

This report is the first study to demonstrate that emodin could lower the expression of CCND1 and C-MYC in MCF-7 cells after treatment for 72 h (Figure 6). Down-regulation of CCND1 and C-MYC blocks the transition of cells from the G₁ phase to the S phase, thereby causing cells to arrest in the G₀/G₁ phase of the cell cycle (Liu et al., 2005; Pelengaris et al., 2002a,b). This G₀/G₁ phase arrest in the cell cycle is an irreversible process in which the cells are unable to repair damages and ultimately undergo apoptosis. This finding explains how emodin inhibits growth and induces apoptosis in MCF-7 cells.

In summary, emodin could induce growth inhibition and apoptosis in MCF-7 cells through the modulation of expression of apoptosis-related genes. Emodin treatment up-regulated FASL gene expression but down-regulated the expression of MCL1, CCND1 and C-MYC. The growth inhibitory effects of emodin might involve both the intrinsic and the extrinsic apoptotic pathways and cell cycle arrest. However, further experiments are needed to elucidate the mechanisms of the activities of emodin.

Declaration of interest

The authors report no conflicts of interest. The authors alone are responsible for the content and writing of this article.

Acknowledgements

We thank the Shenzhen Municipal Key Laboratory Advancement Program, Shenzhen, People’s Republic of China for its support to the project and Ms. Josephine Hong Man Leung for proofreading the manuscript.