Effects of thymol and carvacrol on T-helper cell subset cytokines and their main transcription factors in ovalbumin-immunized mice

Abstract

Thymol and carvacrol, two main components of thyme, have several valuable effects on the immune system. This study aims to evaluate the effects of these components on T-helper (T_H) cell responses and their subsets in mice immunized with ovalbumin. The effects of these components on: a specific in vivo immune response were evaluated by assessing changes in delayed-type hypersensitivity (DTH); ex vivo splenocyte proliferative responses were evaluated using a BrdU assay gene expression of cytokines and key transcription factors involved in T-cells subset differentiation among the mouse splenocytes were assessed using real-time polymerase chain reaction (PCR); and splenocyte cytokine formation (ex vivo) and levels of the cytokines in mouse sera were measured by ELISA. Mice treated with thymol or carvacrol had reduced DTH responses (26% and 50%, respectively) compared with control mice. Thymol and carvacrol each diminished splenocyte proliferation to nearly 65–72% of control levels (p < 0.01). These agents also led to decreased T_H1 [interleukin (IL)-2, interferon (IFN)-γ)], T_H2 (IL-4) and T_H17 (IL-17A) levels in the splenocyte cultures and in the sera of mice but increased levels of IL-10 and transforming growth factor (TGF)-β. Treated immunized mice showed significantly reduced T-box 21 (T-bet) expression from 3.8 [± 0.3]-fold in untreated ovalbumin-immunized mice to 0.9 [± 0.4]-(thymol) and 0.8 [± 0.2]-fold (carvacrol) (p < 0.01). GATA binding protein 3 (GATA-3) expression declined from 3.4 [± 0.4]- to 0.5 [± 0.3]-fold (thymol) and 0.6 [± 0.4]-fold (carvacrol), whereas RORγc decreased from 13.4 [± 1.6]- to 1.5 [± 0.6]-fold (thymol) and 0.8 [± 0.4]-fold (carvacrol) (p < 0.001). As carvacrol and thymol each suppressed the antigen-specific immune response by reducing T_H cell-related cytokines\specific transcription factors, this indicated their potential to modulate destructive immune responses attributed to T-cells over-activation.

Keywords:

• Carvacrol
• immunization
• immunomodulation
• ovalbumin
• T-helper cells
• thymol

Introduction

Although the immune system is properly organized and regulated, dysregulation may lead to the development of hypersensitivity, autoimmune diseases or immune deficiency. Many immune-mediated diseases such as allergies and autoimmune disorders can arise due to an overactive immune system. Between immune effector cells, T-helper (T_H) cells have an important role (Brower 2004) and it is necessary to modulate the activation and inhibition of these cells in immune-related diseases (Huang et al. 2008).

An extensive network of cytokines controls the growth and function of immune system cells. T_H cells possess a key role in this network as they are the main source of numerous cytokines. According to cytokine production patterns, activated T_H cells are divided into various subtypes: T_H1 [classically produce interleukin (IL)-2 and interferon (IFN)-γ]; T_H2 (produce IL-4, IL-5 and IL-10); T_H17 (produce IL-17A); and T-regulatory (T_reg) cells that produce transforming growth factor (TGF)-β and IL-10 (Luckheeram et al. 2012). The imbalance among T_H cell subsets causes a number of destructive immune diseases (Zambrano-Zaragoza et al. 2014). In inflammatory disease states such as rheumatoid arthritis, multiple sclerosis and asthma, the presence of aberrant T_H cell responses plays an essential role in the disease pathogenesis (Amarasekara et al. 2015). Thus, suppression or deviation of the immune response toward a particular effector mechanism is considered desirable as a treatment strategy.

Today, numerous immunosuppressive drugs such as prednisone, rapamycin, cyclosporine A, FK506 or cyclophosphamide are approved for treatment of a number of autoimmune diseases and organ transplantations. However, these medicines have a narrow therapeutic range and induce several serious adverse effects that include hepatotoxicity, insomnia, headaches and induction of diabetes (Wong 2001; Ograczyk et al. 2015; Stine & Chalasani 2015). Therefore, it is essential to search for novel, potential immune-suppressant compounds that have improved safety profiles. In recent years, the uses of medicinal plant products as potential therapeutic agents to suppress the immune response have been investigated by scientists.

Throughout history, herbs have been used for curative purposes. Herbal remedies have become increasingly popular and are often considered safe, effective alternatives for treatments (Purushoth Prabhu et al. 2012). Thymol and carvacrol are two natural constituents found in the essential oil fractions of the Thymus spp. These natural terpenoids exhibit potent antifungal (Ahmad et al. 2011), insecticidal (Tang et al. 2011), antimicrobial (Nostro & Papalia 2012) and anti-inflammatory effects (Landa et al. 2009; Liang et al. 2014). In our previous studies, we observed that thymol and carvacrol reduced inflammatory cytokines IL-1β and tumor necrosis factor (TNF)-α, through modulation of c-Jun N-terminal kinase (JNK), signal transducer and activator of transcription 3 (STAT-3), activator protein 1 (AP-1), and nuclear factor of activated T-cells (NFAT) gene expression (Gholijani et al. 2016). Our previous research showed that thymol and carvacrol had suppressive effects on dendritic cell maturation and function, as well as on select T-cells responses (Amirghofran et al. 2015). These two agents modulated T-cells activity as reflected by reduced IL-2 and IFNγ production by Jurkat cells (a T-cells line) in part through a downregulation of AP-1 and NFAT-2 transcription factors (Gholijani et al. 2015). Despite numerous reports regarding the beneficial anti-inflammatory effects of these components, the precise actions of these components on T-cells and their subsets remain unclear.

Altered T-cells function is a fundamental factor associated with numerous pathologies. Therefore, determining how these components might possibly affect T-cells subsets can increase our information to take better advantage of these natural products. For this purpose, this study sought to investigate potential modulatory effects of thymol and carvacrol in ovalbumin (OVA)-immunized mice as a model to evaluate their impact on in vivo antigen-specific immune responses (Kogiso et al. 2006). In this model, changes in production of T_H1 (IL-2 and IFNγ), T_H2 (IL-4 and IL-5) and T_H17 (IL-17A) selective cytokines as well as IL-10 and TGFβ inhibitory cytokines, and activation of transcription factors involved in T-cells subset differentiation [T-box 21 (T-bet), GATA binding protein 3 (GATA-3), RAR-related orphan receptor C (RORγc) and Forkhead box P3 (FoxP3)] was investigated. It was hoped the data obtained would help in clarifying underlying mechanisms responsible for past-documented beneficial effects of these components in the treatment of various immune-related diseases.

Materials and methods

Materials

Fetal bovine serum (FBS) was purchased from Gibco (Ashland, KY), whereas RPMI 1640 medium, trypan blue, thymol, carvacrol, Freund’s complete adjuvant (FCA) and OVA were purchased from Sigma (St. Louis, MO). Freund’s incomplete adjuvant (FIA) was obtained from BioGene (Mashhad, Iran). IL-2, IFNγ, IL-4, IL-17A and TGFβ ELISA kits were purchased from eBioscience (San Diego, CA). RNX-Plus solution for total RNA isolation was obtained from Sinaclon (Tehran, Iran). High-capacity cDNA reverse transcription kit and SYBR Premix Ex Taq II was purchased from ABI and TAKARA (Torrence, CA), respectively. Lympho-dex was obtained from Inno-Train Diagnostic (Kornberg, Germany). Dexamethasone (DEX) immunosuppressant was obtained from Iran Hormone Company (Tehran). The BrdU cell proliferation assay kit was purchased from Roche (Indianapolis, IN). All other chemicals and solvents used here were of reagent grade.

Experimental animal, immunization and components administration

Male BALB/c mice (6- to 8-weeks old) were obtained from the Center for Comparative and Experimental Medicine of Shiraz University of Medical Sciences. Mice were kept under standard conditions and were provided standard laboratory chow and drinking water ad libitum. All protocols for animal care and treatment were approved by the ethics committee of Shiraz University of Medical Sciences.

A total of 35 mice were divided into five groups, each consisting of seven animals. OVA [at 2 mg/ml in normal saline] was emulsified in an equal volume of FCA and then 0.1 ml of emulsion (1 mg/ml) containing 100 μg OVA was injected subcutaneously (SC) into the shaved backs of mice in four of the groups (OVA-immunized mice). A negative control group was injected SC with normal saline (nonimmunized control). OVA-immunized mice were then treated with intraperitoneal (IP) injections of olive oil as vehicle (OVA-only mice), DEX (2 mg/kg), thymol (80 mg/kg) or carvacrol (80 mg/kg) on each of two days before the first OVA challenge, followed by on every other day for two weeks. The nonimmunized control group received vehicle injections in parallel with the test groups’ regimens. A boosting SC injection of OVA (at the same concentration as in first challenge) in FIA was given on Day 14. Two days later, mice were euthanized by cervical dislocation and their spleen removed. Blood (to generate serum that was then stored at −80 °C) was also collected at necropsy for use in further experiments.

In a separate set of dedicated mice (paralleling each of the regimens above), to permit evaluation of delayed-type hypersensitivity (DTH) reactions, one week after the immunization, 50 μl OVA (1 mg/ml in equal volumes of normal saline and FIA) was injected SC into the left hind paw; the right footpads of mice were injected with saline for measures of nonspecific swelling. After 24 h, footpad thickness was measured using a digital caliper. The extent of the DTH response was estimated by subtracting the right (control) footpad thicknesses from the left footpad thicknesses (test).

Splenocyte proliferation assay

Each mouse spleen was crushed in complete medium (CM10; RPMI 1640 plus 10% FBS) with the flat end of a sterile syringe to obtain a homogeneous cell suspension. Mononuclear cells were separated by density gradient centrifugation over Lymphodex cell separation medium. After enumeration using a hemocytometer, a portion of these cells were cultured in 24-well culture plates for cytokine level/gene expression assays (see below) and another was seeded into 96-well tissue-culture microplates (10⁵cells/well/100 μl) to determine the cell proliferation using a BrdU assay (Amirghofran et al. 2015) that is based on detection of BrdU incorporated into genomic DNA of proliferating cells. The cells in all groups were treated (in triplicate) in the presence of OVA (100 μg/ml) for 48 h at 37 °C and then labeled by the addition of kit-provided BrdU overnight. Cells treated with medium only were used for each group as an internal negative control after removing the labeling medium, the cells were fixed and DNA was denatured by addition of FixDenat for 30 min. After removing the FixDenat, kit-provided anti-BrdU-peroxidase antibody was added, and immune complexes subsequently detected by addition of kit substrate. The amount of reaction product/well was quantified by measuring the absorbance at 450 nm using a microplate reader (Biotek, Winooski, VT).

Cytokine measurements

A total of 5 × 10⁵ splenocytes/well/500 μl/mouse was cultured in 24-well culture plates in the presence of 100 μg/ml OVA (in triplicate). After 24 h, the culture supernatants were collected to examine cell cytokine production. The remaining cells in the wells were collected and underwent analysis of gene expression by real-time polymerase chain reaction (PCR). Levels of IL-2, IFNγ, IL-4, IL-17A and TGFβ in the supernatants – as well as in mice sera – were measured using ELISA kits, according to manufacturer protocols. The sensitivity of the kits was 2 pg IL-2/ml, 15 pg IFNγ/ml, 4 pg IL-4/ml, 4 pg IL-17A/ml and 8 pg TGFβ/ml.

Real-time PCR analysis of cytokines and transcription factors

Total RNA from the splenocytes that had been cultured with OVA or medium (see above) was prepared using RNX-Plus solution according to manufacturer instructions. After confirming RNA concentration [using a Picodrop system (Picodrop, Hinxton, UK)] and integrity (via gel electrophoresis), sample target RNA (10 μl) from each mouse was reverse-transcribed using high-capacity cDNA reverse transcription kit at 37 °C for 120 min in the presence of dNTP mix, reverse transcriptase and random hexamer. For analysis of IFNγ, IL-4, IL-5, IL-10, IL-17, IL-23, TGFβ, Tbet, GATA-3, RORγc and FoxP3, real-time PCR was performed in a final volume of 20 μl containing 2 μl cDNA, 10 μl SYBR Premix Ex Taq II, 0.4 μl ROX reference dye2, 0.8 μl forward primer (10 pM), 0.8 μl reverse primer (10 pM) and 6 μl H₂O. The primers used are indicated in Table 1 (Gholijani et al. 2015); the real-time PCR was performed in a StepOne system (Applied Biosystems, Foster City, CA).

Table 1. Target RNA and gene-specific oligonucleotide primers.

mRNA	Accession #	Primer sequence
GAPDH	NM_001289726	Forward 5′-CGGTGTGAACGGATTTGGC-3′
		Reverse 5′-GTGAGTGGAGTCATACTGGAAC-3′
IFNγ	NM_008337	Forward 5′- GAGGAACTGGCAAAAGGATGGT -3′
		Reverse 5′- CGCTTATGTTGTTGCTGATGGC -3′
Il-4	NM_021283	Forward 5′- CATATCCACGGATGCGACAA -3′
		Reverse 5′- CTCTGTGGTGTTCTTCGTTGCT -3′
IL-5	NM_010558	Forward 5′- ACAAGCAATGAGACGATGAGGC -3′
		Reverse 5′- CACGGACAGTTTGATTCTTCAG -3′
IL-10	NM_010548	Forward 5′- GCAGGACTTTAAGGGTTACTTGGG-3′
		Reverse 5′- GATTTCTGGGCCATGCTTCTC -3′
IL-17A	NM_010552	Forward 5′- AACACTGAGGCCAAGGACTTC -3′
		Reverse 5′- GTCTTCATTGCGGTGGAGAGT -3′
IL-23	NM_031252.2	Forward 5′- TCAAGGACAACAGCCAGTTCTG-3′
		Reverse 5′- AAGATGTCAGAGTCAAGCAGGTG-3′
TGFβ	NM_011577	Forward 5′- GCAACAACGCCATCTAT-3′
		Reverse 5′- AAGGTAACGCCAGGAAT -3′
T-bet	NM_019507	Forward 5′- TAAGCAAGGACGGCGAAT -3′
		Reverse 5′- GGTGGACATATAAGCGGTTC -3′
GATA-3	NM_008091	Forward 5′- CCCATTACCACCTATCCGCC -3′
		Reverse 5′- ACACACTCCCTGCCTTCTGT -3′
RORγc	NM_001293734	Forward 5′- AAGAGAAGAGGAGAGTGGAA -3′
		Reverse 5′- GTGGAGGTGCTGGAAGAT -3′
FoxP3	NM_001199347	Forward 5′- AATAGTTCCTTCCCAGAG -3′
		Reverse 5′- GATTTCATTGAGTGTCCT -3′

PCR conditions were as follows: one cycle at 95 °C for 30 s, followed by 40 cycles at 95 °C for 5 s, IFNγ (59.2 °C), IL-4 (60.8 °C), IL-5 (57.9 °C), IL-10 (59.8 °C), IL-17 (62.4 °C), IL-23 (58.7 °C), TGFβ (58.9 °C), Tbet (63.3 °C), GATA-3 (64.6 °C), RORγc (60.7 °C), FoxP3 (58.3 °C) and GAPDH (housekeeping gene: 55.6 °C) for 18 s, and finally 72 °C for 30 s. Results of target mRNA levels were normalized against GAPDH mRNA in each sample. All target genes results were presented as relative fold-change (RFC) from non-immunized control group values.

Statistical analysis

Data were expressed as mean ±  SD [unless otherwise specified]. Significant differences between groups were evaluated using Prism software (GraphPad, San Diego, CA) containing appropriate statistical tests, e.g. one-way analysis of variance [ANOVA] and a Student’s t-test. A p value <0.05 was considered significant.

Results

Effects of thymol and carvacrol on DTH response

In the evaluations of the DTH responses, the mean value for the OVA-only mice was taken as 100%. As demonstrated in Figure 1, thymol treatments resulted in a significantly decreased footpad thicknesses to 26.1 [± 8.9 (SE)]% (p < 0.01) whereas use of carvacrol led to a decrease to 50 [± 8.3 (SE)]% (p < 0.05).

Figure 1. Effects of thymol and carvacrol on DTH reactions. OVA-immunized mice treated with thymol and carvacrol received an SC injection of 50 μl of OVA (1 mg/ml) into the left footpad; right footpad received saline [to measure nonspecific swelling]. A nonimmunized group and an untreated OVA-immunized (OVA-only) group were also injected with OVA in the left footpads [and saline in right] to serve as controls. After 24 h, DTH responses were estimated (see Materials and methods). Bars shown are mean [± SE] footpad thickness changes in each group (n = 7/group). Value significantly different from OVA-only group (100%) at *p < 0.05, **p < 0.01, or ***p < 0.001.

Effects of treatments on ex vivo splenocyte proliferation

To detect effects of each agent on specific proliferative responses, all harvested splenocytes were cultured in the presence of OVA (100 μg/ml) and proliferation then evaluated using a BrdU assay. As shown in Figure 2, OVA immunization led to a significantly increased cell proliferation in the presence of the antigen (100%). Mice that had been treated with thymol had a reduced proliferation relative to that in the OVA-only mice (down to 72 [± 19.3]%; p < 0.01) Cells from mice that had been treated with carvacrol had a relative level of just 65.5 [± 11.7]% (p < 0.001). Dexamethasone (DEX) resulted in a decrease to 58.3 [± 10.9]% vs. the levels for cells from OVA-only mice (p < 0.001).

Figure 2. Effects of thymol and carvacrol on ex vivo splenocyte proliferative activity. Splenocytes from mice [nonimmunized control and four OVA-immunized groups challenged either with vehicle (OVA-only), DEX, thymol or carvacrol] were isolated and then cultured in the presence of OVA for 48 h to examine cell proliferation (via BrdU assay). The proliferative activity of cells from the OVA-only mice was considered to be 100%. Values shown are means [± SD] (n = 7/group). Value significantly different from OVA-only mice at **p < 0.01 or ***p < 0.001.

Effects of treatments on splenocyte cytokine gene expression

Using gene analyses via real-time PCR, as seen in Figure 3(A), in cells that had been cultured with OVA, OVA-immunization of the mice by itself in general increased IFNγ mRNA levels, i.e. 2.4 [± 0.1] RFC compared with values in cells from nonimmunized control mice (p < 0.01). Treatment of mice with thymol decreased this to 1.7 [± 0.1] RFC (p < 0.05) and carvacrol caused a decrease to 1.0 [± 0.3] RFC (p < 0.01). DEX had a stronger inhibitory effect, i.e. 0.5 [± 0.2] RFC (p < 0.001).

Figure 3. Effects of thymol and carvacrol on splenocyte cytokine gene expression. Splenocytes from mice [nonimmunized control and four OVA-immunized groups challenged either with vehicle (OVA-only), dexamethasone, thymol or carvacrol] were isolated and then cultured in the presence of OVA for 24 h in order to examine cytokine gene expression (via real-time PCR). Results of target mRNA levels were normalized against GAPDH mRNA in each sample; outcomes are presented as RFC compared with nonimmunized control group cells. Values shown are means [± SD] (n = 7/group). Value significantly different from OVA-only group at *p < 0.05, **p < 0.01 or ***p < 0.001.

Treatments with thymol and carvacrol led to reduced level of IL-4 mRNA relative to those of the OVA-only mice cells. Specifically, levels of IL-4 mRNA were reduced from 7.8 [± 0.3] RFC in OVA-only mouse cells to 3.9 [± 0.4] RFC (thymol; p < 0.001) and to 1.2 [± 0.5] RFC (carvacrol; p < 0.001). The thymol- and carvacrol-treated cells were also associated with a reduction in IL-5 mRNA levels. Though DEX led to a reduced IL-4 mRNA expression of 1.4 [± 0.4] RFC (p < 0.001), it had no significant effect on IL-5 mRNA levels (Figure 3B and C).

As shown in Figure 3(D) and (E), thymol and carvacrol reduced IL-17A and IL-23 mRNA levels relative to those of the OVA-only mice cells. Specifically, levels of IL-17A mRNA decreased from 3.5 [± 0.4] RFC in untreated OVA-only mouse cells to 0.7 [± 0.1] (p < 0.001) in cells from thymol-treated mice and to 0.3 [± 0.1] (p < 0.001) in cells from carvacrol-treated mice. IL-23 mRNA levels decreased by >85% (thymol; p < 0.05) and 61% (carvacrol; p < 0.05). DEX had no significant effect on IL-17 mRNA levels but reduced those of IL-23 to ∼71% (p < 0.05).

Mice treated with thymol (p < 0.05), carvacrol (p < 0.05), or DEX (p < 0.01) each had significantly amplified IL-10 gene expression compared with those in cells from OVA-only mice (Figure 3F). TGFβ mRNA levels increased from 0.3 [± 0.01] RFC in OVA-only mice cells to 0.5 [± 0.01] RFC (thymol; p < 0.05), 0.7 [± 0.1] RFC (carvacrol; p < 0.01), and 0.7 [± 0.1] RFC (DEX; p < 0.01; Figure 3G).

Effects of treatments on cytokine production in splenocyte cultures

As seen in Figure 4(A) and (B), T_H1 cytokine (IL-2 and IFNγ) levels in cultures of OVA-only mice splenocytes stimulated with OVA were 34.3 [± 1.9] pg IL-2/ml (p < 0.001) and 536.4 [± 26.3] pg IFNγ/ml (p < 0.001). Due to host treatment with thymol or carvacrol, these levels were reduced to 26.9 [± 1.9] pg IL-2/ml for thymol (p < 0.05) and 11.3 [± 1.1] pg IL-2/ml for carvacrol (p < 0.001). Levels of IFNγ were reduced to 309.8 [± 37.1] pg IFNγ/ml for thymol (p < 0.01) and 116.0 [± 17.1] pg IFNγ/ml for carvacrol (p < 0.001). DEX caused reductions in both cytokines (p < 0.01).

Figure 4. Effects of thymol and carvacrol on ex vivo splenocyte cytokine production. Splenocytes from mice [nonimmunized control and four OVA-immunized groups challenged either with vehicle (OVA-only), dexamethasone, thymol or carvacrol] were isolated and then cultured in the presence of OVA for 24 h to examine production of select cytokines (via ELISA). Values shown are means [± SD] (n = 7/group). Value significantly different from OVA-only mice at *p < 0.05, **p < 0.01 or ***p < 0.001.

As shown in Figure 4(C) and (D), thymol treatment of the mice led to reductions in IL-4 formation by cells from the OVA-only mice (p < 0.01) and also in IL-17 secretion (p < 0.05). Carvacrol treatments of the mice were also associated with a decrease in IL-4 and IL-17 levels (p < 0.05). DEX treatment of the mice had no effects on IL-4 formation by splenocytes from these hosts, but did lead to significantly reduced IL-17 formation (p < 0.05). In contrast, as seen in Figure 4(E), TGFβ levels increased from 16.1 [± 2.3] pg TGFβ/ml (OVA-only mice cells) to 77.1 [± 6.5] pg TGFβ/ml (p < 0.01) by cells from thymol-treated mice and 194.0 [± 19.4] pg TGFβ/ml (p < 0.001) by cells of carvacrol-treated mice. DEX treatment of the mice had no effects on TGFβ formation by splenocytes from these hosts.

Effect of treatments on cytokine levels in serum

As shown in Figure 5(A) and (B), in line with the results of the splenocyte cultures, the test agents seemed to give rise to significantly decreased IL-2 levels in the blood of these hosts. Specifically, levels decreased from 26.5 [± 0.7] pg IL-2/ml in OVA-only mice to 10.6 [± 0.8] (thymol; p < 0.001) and 6.2 [± 1.0] pg/ml (carvacrol; p < 0.001). Similarly, serum IFNγ levels showed a decrease in thymol-treated (p < 0.01) and carvacrol-treated mice (p < 0.001). Thymol and carvacrol reduced IL-4 levels from 533.4 [± 43.0] pg IL-4/ml to 364.4 [± 31.3] (thymol; p < 0.05) and 259.8 [± 69.7] pg/ml (carvacrol; p < 0.01). Each agent also led to reduced IL-17A levels (p < 0.05) (Figure 5C and D). Thymol and carvacrol only led to increases in one of the measured cytokines, TGFβ (Figure 5(E)). Specifically, TGFβ levels were increased from 13.0 [± 1.1] pg TGFβ/ml in the OVA-only mice to 77.4 [± 17.5] pg/ml (thymol; p < 0.01) and 135.3 [± 13.4] pg/ml (carvacrol; p < 0.001). DEX as expected decreased serum levels of most cytokines; however, only the decrease in IL-17 was significant (p < 0.01).

Figure 5. Effects of thymol and carvacrol on serum cytokine levels. Sera from mice [nonimmunized control and four OVA-immunized groups challenged either with vehicle (OVA-only), dexamethasone, thymol or carvacrol] were isolated and then evaluated for levels select cytokines (via ELISA). Values shown are means [± SD] (n = 7/group). Value significantly different from OVA-only mice at *p < 0.05, **p < 0.01 or ***p < 0.001.

Thymol and carvacrol effects on T-helper cell transcription factors

Splenocytes from all the mice were evaluated for gene expression of key transcription factors involved in T-cells subset differentiation, e.g. T-bet [T_H1 transcription factor], GATA-3 [T_H2 transcription factor], RORγc [T_H17 transcription factor] and FoxP3 [T_reg transcription factor] 24 h after stimulation ex vivo with OVA. As shown in Figure 6, OVA-immunization itself increased expression of T-bet (3.8 [± 0.3] RFC; p < 0.01), GATA-3 (3.4 [± 0.4] RFC; p < 0.01), RORγc (13.4 [± 1.6] RFC; p < 0.001) and FoxP3 (2.1 [± 0.2] RFC; p < 0.05) compared with cells from nonimmunized control mice (that were also stimulated with OVA for 24 h). Treatment of OVA-immunized mice with thymol and carvacrol significantly reduced T-bet values to 0.9 [± 0.4] RFC for thymol (p < 0.01 vs. OVA-only mouse cell values) and 0.8 [± 0.2] RFC for carvacrol (p < 0.01; Figure 6A). GATA-3 levels were decreased by >85% and 82% (p < 0.001) in cells from thymol- or carvacrol-treated mice, respectively (Figure 6B). RORγc levels declined to 1.5 [± 0.6] RFC in mice treated with thymol (p < 0.001) and 0.8 [± 0.4] RFC in hosts that received carvacrol (p < 0.001; Figure 6C). Comparatively, DEX treatments of the hosts reduced T-bet, GATA-3 and RORγc to <2.5 RFC (p < 0.01) as seen in Figure 6(A–C). None of the treatments significantly altered gene expression of FoxP3 transcription factor (Figure 6D).

Figure 6. Effects of thymol and carvacrol on T-helper cell subset transcription factors. Splenocytes from mice [nonimmunized control and four OVA-immunized groups challenged either with vehicle (OVA-only), dexamethasone, thymol or carvacrol] were isolated and then cultured in the presence of OVA for 24 h to examine T-bet, GATA-3, RORγc and FoxP3 gene expressions [by real-time PCR]. Results of target mRNA levels were normalized against GAPDH mRNA in each sample and are shown as RFC compared with non-immunized control group cells. Values shown are means [± SD] (n = 7/group). Value significantly different from OVA-only group at *p < 0.05, **p < 0.01 or ***p < 0.001.

Discussion

Thymol and carvacrol are the major components of important medicinal plants such as Thymus vulgaris. In many studies, anti-inflammatory effects of these components have been reported (Landa et al. 2009; Liang et al. 2014). In our previous studies, inhibitory effects of thymol and carvacrol on maturation and function of dendritic cells as well as various transcription factors and signaling molecules involved in inflammatory responses of activated T-cells have been shown (Amirghofran et al. 2015; Gholijani et al. 2016).

This study aimed to examine in vivo effects of thymol and carvacrol on antigen-specific T-cells responses and effects on T_H cell subsets, using OVA-immunized mice as a model, and hosts subsequently treated with thymol, carvacrol or DEX (immunosuppressant). In the analyses of the in vivo effects of thymol and carvacrol on a T cell-mediated response, i.e. DTH, it was seen that each agent significantly suppressed DTH in treated mice. These results were in accordance with those of (Juhás et al. 2008) who reported that a high concentration of thyme essential oil diminished contact hypersensitivity as a DTH reaction.

These studies here also revealed that splenocytes from OVA-immunized mice – as expected – had significantly increased proliferation when cultured in the presence of the antigen. However, similarly immunized mice treated with thymol and carvacrol had cells with reduced proliferation. Thymol and carvacrol reduced splenocyte formation of IL-2, a cytokine important for T_H cell growth and survival. Use of each agent also led to reduced IFNγ formation, a key T_H1 cytokine required for proliferation. As DTH reactions are mediated by IFNγ-producing T_H1 lymphocytes, the induced reductions in IFNγ formation by the test agents could be a major mechanism underlying this specific immunosuppressed outcome.

That each agent impacted on formation of key T_H1 and T_H2 cytokines by host splenocytes could have profound implications because: T_H1 cells are critical to the pathogenesis of many inflammatory diseases, autoimmune diseases, contact dermatitis, acute allograft rejection, etc. (Kidd 2003); T_H2 cells are implicated in allergy and asthma (Lu et al. 2013); and, changes in T_H cell activity may contribute significantly to various diseases such as systemic sclerosis, systemic lupus erythematosus and chronic graft-versus-host disease (Luckheeram et al. 2012), this finding suggested the suppressive effects of thymol and carvacrol could be of some potential benefit to treating immune-based diseases.

Although it is possible that targeting of T_H1 and T_H2 cells by use of thymol or carvacrol could be a benefit worth pursuing, other T_H cell types could also be impacted by these treatments (again in a beneficial yet possibly in a detrimental manner). For example, T_H17 cells have a protective role in host defense and their inappropriate/uncontrolled activation is involved in various chronic inflammatory/autoimmune-mediated diseases including inflammatory bowel disease, rheumatoid arthritis, multiple sclerosis, psoriasis and asthma (Tesmer et al. 2008). Although IL-17 is the main cytokine produced by T_H17 cells, and IL-23 is an important pro-inflammatory cytokine critical for differentiation of these cells, it is ultimately the IL-23\IL-17 axis that results in immune activation and, ultimately, chronic inflammation. As such, targeting of the IL-23\IL-17 pathway could be a novel therapeutic to treat chronic inflammatory diseases (Iwakura & Ishigame 2006; Toussirot 2012). In this study, thymol and carvacrol each led to observed reduced IL-17 formation in/by cells from the treated hosts. Thus, each agent once again provided further evidence of potential utility for the treatment of inflammation/immune-based pathologies.

These data also showed these immunosuppressive effects of thymol and carvacrol were seemingly mediated though effects on cytokine gene expression in the mice splenocytes. Although this is a broad observation, this study sought to determine if the changes in expression (in sera and ex vivo) in these cytokines and their mRNA was due to induced changes in key transcription factors involved in T-cells subset differentiation. The results showed that thymol and carvacrol reduced expressions of T-bet, GATA-3 and RORγc transcription factors essential to the maturation/function of T_H1, T_H2 and T_H17 cells, respectively.

This study also evaluated potential effects of the test agents on production (and gene expression) of inhibitory cytokines IL-10 and TGFβ by splenocytes in vivo and ex vivo. The results showed increased levels associated with the thymol and carvacrol treatments. Various cells, including regulatory T (T_reg) cells, produce IL-10 and TGFβ; T_reg cells have major roles in suppression of allergies and asthma, prevention of autoimmune diseases and suppressing pathogen-induced immunopathology (Corthay 2009). There is evidence that T_reg cells contribute to cell-mediated immune responses, in part, by directly affecting T_H1, T_H2, and T_H17 cell reactions against antigens. Although all the mechanisms by which T_reg cells exert their function are not completely known, immunoinhibitory cytokines such as TGFβ and IL-10 appear to play an important role (Corthay 2009).

Foxp3 is crucial in the development and function of T_reg cells. This transcription factor inhibits IL-2 transcription and induces upregulation of T_reg cell-associated molecules, such as cytotoxic T-lymphocyte-associated protein (CTLA)-4 and CD25 (Nishikawa & Sakaguchi 2014). In this study, an evaluation of effects of thymol and carvacrol on FoxP3 failed to show any significant impact. This suggested to us that the production of the inhibitory cytokines IL-10 and TGFβ were likely due to other cell sources rather than T_reg cells. Further studies characterizing the individual T-cells populations in these hosts (and other strains; Chen et al. 2005) are needed to validate this point in our model.

Conclusion

These studies showed that thymol and carvacrol could suppress an antigen-specific immune response in vivo, in part, by inducing reductions in T_H1, T_H2 and T_H17 cell-related cytokines and key transcription factors involved in their differentiation. Despite increases observed in IL-10 and TGFβ inhibitory cytokine expression, no significant elevation in T_reg cell-specific transcription factor(s) was detected. At this time, precise mechanisms underpinning these observed effects remain undefined. Nevertheless, because T_H1, T_H2, and T_H17 cell subsets are implicated in inflammatory and autoimmune disorders, additional studies are warranted to further explore the potential for thymol and carvacrol to be used to ultimately benefit individuals suffering from immune-based pathologies/diseases.

Funding information

Shiraz University of Medical Sciences (Grant #6297).

Acknowledgements

This study was extracted from the thesis written by one of the authors N. Gholijani.

Disclosure statement

The authors declare no conflicts of interest. The authors alone are responsible for the content and writing of this article.