Role of Ghrelin on Estrogen and Progesterone Secretion in the Adult Rat Ovary During Estrous Cycle

Abstract

The objective of the present study was to evaluate the effects of ghrelin on the concentrations of estrogen (E₂) and progesterone (P₄) in serum and the mRNA expression of estrogen receptor beta (ER_β) and progesterone receptor (PR_A+B) in ovary in rats during estrous cycle. Adult female Sprague Dawley rats were intracerebroventricularly (i.c.v.) injected with 3 nmol ghrelin during the estrous cycle, and sacrificed 15 min later. Blood samples and ovaries were collected. The concentrations of serum E₂ and P₄ were measured by radioimmunoassay, while the amount of ER_β and PR_A+B mRNA was assessed by real-time quantitative PCR. Our studies showed that ghrelin could significantly reduce the serum concentration of E₂ throughout the estrous cycle (P < 0.05), the serum level of P₄ (P < 0.05), and the amount of ER_β mRNA during metestrus (P < 0.05). Meanwhile, the amount of PR_A+B mRNA was only reduced during diestrus (P < 0.05). Overall, our present findings provide the first evidence that i.c.v. injection of ghrelin could reduce the serum concentration of E₂ and P₄ and the level of ER_β and PR_A+B mRNA expression, supporting the role of ghrelin in reproduction.

Keywords:

• Estrogen
• ghrelin
• mRNA
• progesterone
• rat

Introduction

Ghrelin, a 28-amino-acid peptide requires serine 3 n-octanoylation. It is a pleiotropic regulator involved in a wide array of endocrine and non-endocrine functions [Wren et al. 2000; Horvath et al. 2001]. Moreover, a growing number of studies suggest that ghrelin may play a role in the regulation of reproduction. For example, the concentration of estrogen (E₂) and progesterone (P₄) in cultured granulosal-luteal cells of women is significantly reduced by ghrelin in a dose-dependent manner [Viani et al. 2008]. The treatment of cultured granulosal cells of rabbits with ghrelin has recently been found to increase P₄ secretion at 1 ng/mL and decrease it at 10 ng/mL [Sirotkin et al. 2009]. Nevertheless, it has been shown that 250 or 500 pg/mL doses of ghrelin stimulates E₂ secretion of prepubertal porcine follicular cells in vitro [Rak and Gregoraszczuk 2008]. Increasing evidence indicates that ghrelin could also be involved in controlling gonadal function [Wang et al. 2011].

E₂ and P₄ play important roles in the regulation of female reproduction, and their actions are mediated through their receptors. It has been shown that most female reproductive organs express both ER_α and ER_β [Mowa and Iwanaga 2000]. However, estrogen receptor subtypes differ in both concentration and ratio in various tissues [Jefferson et al. 2000; Igarashi et al. 2001]. It has been suggested that ER_β is the dominant estrogen receptor (ER) subtype in the ovary [Byers et al. 1997]. The granulosal and thecal cells of the preovulatory follicles express both progesterone receptor A and B (PR_A+B) [Gava et al. 2004]. The relative levels of expression of these receptors may play a major role in the ovary. To gain further insight, the serum level of E₂ and P₄ and the expression of ER_β and PR_A+B mRNA in the ovary were assessed in rat following i.c.v. injection of ghrelin.

Results

E₂ and P₄ concentration changes after i.c.v. injection of ghrelin

The highest E₂ levels were observed proestrus. The i.c.v injection of ghrelin in cyclic rats induced a significant decrease in serum levels of E₂ throughout the estrous cycle compared with the control (P < 0.05) (Table 1).

Table 1. Serum level of E₂ (mean ± SD) after i.c.v. injection of ghrelin in rats during the estrus cycle.

Group	proestrus(pg/mL)	estrus(pg/mL)	metestrus(pg/mL)	diestrus(pg/mL)
Control (0 nmol)	8.40 ± 1.84	5.62 ± 1.21	4.16 ± 0.34	3.82 ± 0.56
Ghrelin (3 nmol)	3.82 ± 1.13*	3.54 ± 0.65*	1.83 ± 0.41*	1.43 ± 0.59*

*indicates significant difference between control and ghrelin injected group ( P < 0.05)

The results in Table 2 show that the level of P₄ was the highest in diestrus but lowest in estrus. The serum levels of P₄ were inhibited during metestrus compared with the control (P < 0.05) following ghrelin i.c.v. injection to cycling rats.

Table 2. Serum level of P₄ (mean ± SD) after i.c.v. injection of ghrelin in rats during the estrus cycle.

Group	Proestrus (ng/mL)	estrus (ng/mL)	metestrus (ng/mL)	diestrus (ng/mL)
Control (0 nmol)	32.02 ± 7.65	11.93 ± 1.88	27.75 ± 3.44	56.05 ± 12.70
Ghrelin (3 nmol)	25.61 ± 5.67	10.05 ± 2.28	13.68 ± 2.63*	42.02 ± 7.56

*indicates significant difference between control and ghrelin injected group ( P < 0.05)

ER_β mRNA analysis in ovary

The results showed that the level of ER_β mRNA was highest proestrus. In comparison, the ER_β mRNA in ghrelin injected rats, was significantly inhibited during metestrus (P < 0.05). As summarized in Figure 1A, no significant change was observed in ER_β mRNA expression during the other stages of the estrous cycle (P > 0.05).

Figure 1.  A) Levels of ER_β mRNA in the ovary after i.c.v. injection of ghrelin during the estrus cycle. The RNA levels during proestrus, estrus, metestrus, and diestrus are compared to the saline control following ghrelin administration. B) Expression of PR_A+B mRNA in the ovary after i.c.v. injection of ghrelin in rats during the estrus cycle. *indicates significant difference between control and ghrelin injected group (P < 0.05)

PR_A+B mRNA level in ovary

The PCR primers used in this study along with the corresponding products are described in Table 3. The amount of PR_A+B mRNA was highest in proestrus, and lowest in metestrus (Fig. 1B) in both the control and ghrelin groups. The level of PR_A+B mRNA was significantly reduced during diestrus compared with the control (P < 0.05) following i.c.v. injection of ghrelin. However, there was no difference in PR_A+B mRNA expression at other stages (P > 0.05) (Fig. 1A).

Table 3. Real-time PCR primer and size of the amplification products of target genes (ER_β,PR_A+B) and housekeeping (β- actin).

Gene	Forward primer, 5′-3'	Reverse primer, 5'-3'	Product, bp
ERβ	GGCACAACTGCTCCCACT	GTCTCCTTTAGCGACCCA	145
PRA+B	AATCAGGGTTATCTGGTCATC	GGTTCCGCCACTCATCAA	205
β- actin	CAGTGGTTGACCCTGCTA	TGTTGTCCCTGTATGCCT	208

Discussion

Emerging evidence suggests that ghrelin can regulate E₂ and P₄ secretion in vitro. The data presented in this communication demonstrated that ghrelin could induce differential inhibition of E₂ and P₄ secretion as well as ER_β and PR_A+B mRNA expression. I.c.v. injection of ghrelin, inhibited the release of E₂ throughout the estrous cycle. As such, the level of E₂ detected in serum decreased. This may reflect the action of luteinizing hormone (LH), which could stimulate the ovaries to produce E₂. It has been observed that ghrelin can inhibit the release of LH at all stages of the estrous cycle [Fernández-Fernández et al. 2005]. Recently, Rak and Gregoraszczuk [2008] showed that ghrelin directly inhibits aromatase activity thereby decreasing E₂ secretion. However, Messini et al. [2009] showed that the serum concentration of E₂ remained constant in women with a normal menstrual cycle who were subject to i.v. injection of ghrelin (1 mg/kg). This discrepancy may result from the delivery methods and different dosages of ghrelin.

Tropea et al. [2007] have shown that 10⁻¹³-10⁻⁷M ghrelin could significantly inhibit basal and human chorionic gonadotropin-stimulated progesterone release in women. As shown here, i.c.v injection of ghrelin evoked a significant decrease of P₄ during metestrus. This is likely due to the increase of GHS-R_1a in the hypothalamus during metestrus [Fernández-Fernández et al. 2005]. In addition, ghrelin could inhibit P₄ secretion through mitogen-activated protein kinase (MAPK) and protein kinase A (PKA)-dependent intracellular mechanisms, at the post-receptor level [Sirotkin and Grossmann 2007; 2008]. In contrast, the concentration of serum P4 was not altered in women with a normal menstrual cycle who received 1 mg/kg ghrelin [Messini et al. 2009]. Results obtained from rats and women support the view that ghrelin may regulated P₄ secretion in a species or delivery specific manner. If correct this can be only one of the mechanisms regualting the secretion of P₄ since it is also influenced by platelet-activating factor, epidermal growth factor, vascular endothelial growth factor, prostaglandin, and their interactions [Rabinovici and Angle 1991; Liu et al. 1998; Dickson et al. 2001; Arosh et al. 2004].

The results of the present study show that ER_β mRNA was present during the estrous cycle with the level being maximum during proestrus and then decreasing during estrus. This is similar to what has been observed by others [Byers et al. 1997; Misao et al. 1999]. However, the opposite pattern of ER expression has been reported for the rhesus monkey [Duffy et al. 2000]. I.c.v. injection of ghrelin evoked a significant decrease of ER_β mRNA during metestrus. This may reflect the action of follicle stimulating hormone (FSH) since the level of ER_β mRNA decreases significantly in FSH-antiserum-treated ovaries [Yang et al. 2004]. However, FSH secretion was inhibited by ghrelin during metestrus [Fernandez-Fernandez et al. 2005]. This suggests that ghrelin plays a physiological role in ER_β mRNA expression in rats during the estrous cycle. However, ER_β mRNA expression is also subjected to a range of other factors, including histone deacetylase inhibitors, and estrogen [Read et al. 1989; Duong et al. 2006].

Although the PR_A+B protein has been observed in the ovary [Gava et al. 2004], information regarding the control of gene expression at the mRNA level is still lacking. As shown above, the amount of PR_A+B mRNA decreased in proestrus and increased in diestrus, the patterns of which were similar to the PR_A+B mRNA expression in the anterior pituitary [Szabo et al. 2000]. Others have shown that the PR_A+B mRNA level was differentially regulated in follicles and corpus luteum during the estrous cycle [Berisha et al. 2002]. This discrepancy suggests that PR_A+B mRNA expression was regulated in a tissue-specific manner. However, PR_A+B mRNA expression in the anterior pituitary and ovary showed approximately the same changes. The reasons for this apparent dichotomy are unclear. The amount of PR_A+B mRNA was significantly inhibited during diestrus when the rats were treated with ghrelin. It may be associated with an increased plasma P₄ level in diestrus, because PR_A+B mRNA expression was down-regulated by P₄ [Kraus and Katzenellenbogen 1993]. During metestrus, P₄ secretion was significantly inhibited by ghrelin. While the administration of ghrelin by i.c.v has suggested a possible role in the control of the gonadal hormone secretion and the expression in ER_β mRNA and PR_A+B mRNA, the mechanisms of such actions remain obscure. Further research is needed to identify the precise role of ghrelin.

Materials and Methods

Animals and experimental design

Sprague Dawley rats (180-240g) were purchased from the Experimental Animal Center of Anhui Medical University. The study was approved by the Animal Care and Use Committee of Anhui Agricultural University. The rats were kept (6 per cage) under controlled conditions of light (12 h light, 12 h darkness, light at 07:00 h) and temperature (22^oC), with free access to pelleted food and tap water, and relative humidity of 50%-60%. Vaginal smears were examined daily for identifying the stage of estrus cycle. Only those animals exhibiting at least two consecutive 4-day estrous cycles were used. Animals were divided into four groups (proestrus, estrus, metestrus, and diestrus) by vaginal cell morphology [Zhang et al. 2006], each experimental group and control group consisted of eight animals. Ghrelin was obtained from Sigma (USA) and dissolved in saline solution immediately before use. The experimental group of rats were intracerebroventricularly (i.c.v.) injected with 2 µL ghrelin solution (2 nmol ghrelin), while the control animals received 2 µL of saline. The ghrelin or saline injection time was either in the afternoon of proestrus (17:30 h), the morning of estrus (07: 30 h), metestrus (10:00 h), or diestrus (9:00 h ) [Fernández-Fernández et al. 2005]. All animals were decapitated 15 min after injection with ghrelin (plasma ghrelin levels rapidly decreased with a half-life of 11 min). Approximately 5mL of blood samples were collected into centrifuge tubes without heparin and centrifuged (1,600 g at 4^oC for 20 min) immediately, serum was collected and stored at −20^oC until use. In parallel, the ovaries were rapidly dissected out and then stored at −80^oC until analysis.

E₂ and P₄ determination

The concentrations of E₂ and P₄ in serum and culture media were measured using a commercial RIA system according to manufacturer's instructions (Furui Bioengineering Corporation, Beijing, China). The intra- and inter-assay coefficients of variation were less than 7.3% and 10.3% for E₂ and 8.8% and 12.1% for P₄, respectively. The sensitivity was 0.5 pg/mL for E₂ and 0.002 ng/mL for P₄. All samples were assayed in duplicate.

Total RNA isolation and reverse transcription

Total RNA was extracted from the ovary, granulosa cells, and luteal cells using a Trizol reagent (TransGen, Beijing, China) according to the manufacturer's instructions. The quality of total RNA was assessed by formaldehyde gel electrophoresis. Samples that showed good RNA quality (i.e., low degradation and presence of 2 ribosomal peaks) were selected for further reverse transcription. Reverse transcription was performed by TransScript First-Strand cDNA Synthesis SuperMix (TransGen, Beijing, China) according to the manufacturer's instructions. A total of 4 μg of total RNA in 30 μL was used for reverse transcription.

Real-time PCR

The ER_β and PR_A+B target genes, and β-actin as the housekeeping internal control gene primers are listed in Table 3. Real-time PCR was performed using SYBR Premix Ex Taq^TM Kits (TaKaRa, Dalian, China). Each reaction well in a 96-well plate contains 25 pmol/μL forward and reverse primers, 1× Hotstart Fluo-PCR mix and 1 µL cDNA. The final reaction volume was 30 µL and all samples were run in triplicate. The following PCR conditions were used: preliminary denaturation at 95°C for 30 s, followed by 40 cycles with temperature profiles of 5 s at 95°C, 20 s at 55°C, and 15 s at 72°C. Melting curves were determined. Quantitative analysis was performed using a relative standard curve method. The data were analyzed and shown as a ratio of analyzed gene expression to β-actin.

Statistical analyses

Results presented as mean ± SD. Differences in the concentrations of E₂ and P_4, the ER_β and PR_A+B relative mRNAs were determined by one-way repeated-measures ANOVA, where P < 0.05 was considered statistically significant.

Declaration of Interest: Supported by Natural Science Foundation of Anhui Education Department (Grant KJ2011A117) (Anhui, P. R. China). The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the paper.

Abbreviations

GHS-R1a	=	growth hormone secretagogue receptors
i.c.v	=	intracerebroventricularly
GHS-R	=	growth hormone secretagogue receptor
LH	=	luteinizing hormone
FSH	=	follicle-stimulating hormone
E2	=	estrogen
P4	=	progesterone
ER	=	estrogen receptor
ERβ	=	estrogen receptor beta
MAPK	=	mitogen-activated protein kinase
PKA	=	protein kinase A
PRA+B	=	progesterone receptor A and B.