Inhibition of metadherin sensitizes breast cancer cells to AZD6244

Abstract

The development of systemic therapy drug resistance for breast cancer treatment is an ongoing problem, thus, so are the potential molecular mechanisms of it. AZD6244 is a novel ATP-uncompetitive inhibitor to MAP/ERK kinase (MEK) 1/2 which has been demonstrated to be potent, selective and safe in the clinical trials and previous studies. However, the precise role of resistance to AZD6244 is largely unknown. We and other groups have reported that the novel oncogene Metadherin (MTDH) is associated with multiple drug resistance, but there is no report about its role in treatment of AZD6244. Here we report that the resistance to AZD6244 can be reserved by downregulating MTDH in breast cancer cell lines. When the MTDH was downregulated, the breast cancer cells exhibited a significantly increased sensitivity to AZD6244 as measured by MTT assay. After treated with AZD6244 the MTDH-knockdown cells showed more apoptosis rate and growth inhibition. We also showed that knockdown of MTDH cannot only increase expression of FOXO3a but also activate it by promoting its translocation via MTDH/ERK1/2/FOXO3a pathway rather than MTDH/AKT/FOXO3a pathway. In conclusion knockdown MTDH can enhance the breast cancer cells sensitivity to AZD6244 via regulating the expression and activity of FOXO3a. These indicate us that MTDH is a candidate marker to predict the clinical efficacy of AZD6244 and targeting MTDH could overcome the resistance to AZD6244 in breast cancer cells.

Keywords: :

• AZD6244
• breast cancer
• nuclear translocation

Introduction

Breast cancer is the most common female cancer in the world and has become the first cause of cancer death in women of developing countries.^1,2 Despite the recent advances made in breast cancer treatment utilizing improved local and systemic treatments to improve disease-free and overall survival in the general female breast cancer population, about one-third of patients diagnosed with early-stage breast cancer eventually die of recurrent disease due to the development of drug resistance to systemic therapy.^3,4 The specific nature in which certain breast cancers develop chemotherapy resistance, the biologic mechanisms of action, and the role of genes involved in the transport of anticancer agents that lead to resistance remain unclear. In order to overcome drug resistance to breast cancer therapies and develop successful therapeutic strategies to overcome drug resistance, a better understanding of the underlying molecular mechanisms is mandatory. The magnitude of the resistance problem has prompted both pre-clinical and clinical efforts at identifying underlying prognostic features for drug resistance and potential mechanisms of action.

The understanding of certain oncogenes and their signal transduction cascades which lead to tumor development, proliferation, cell death, angiogenesis and metastasis⁵ has provided for the development of targeted therapies for receptors such as estrogen receptor, HER2 (human epidermal growth factor receptor) and VEGF (vascular endothelial growth factor). Currently, a large percentage of breast cancer patients will receive some form of targeted therapy, which have been demonstrated to improve breast cancer outcomes, including local control, distant-disease free survival, and overall survival.^6-8

Unfortunately, a significant number of patients develop drug resistance to these agents. The mechanism of drug resistance is likely to be heterogenous and multi-factoral and thus, extensive investigation of individual agents and pathways leading to drug resistance will need to be conducted.

Activated extracellular signal-regulated kinase (ERK1/2) in breast cancer has been reported to be essential for cell proliferation, differentiation, survival, tumor angiogenesis, motility and invasion,^10-13 and is activated by MEK1/2 via phosphorylation.⁹ It has been recently described that Selumetinib (AZD6244, ARRY-142886), a novel potent oral inhibitor of MEK1/2 kinases, is an active inhibitor of the RAF/MEK/ERK pathway, and thus has potential to block cell proliferation, survival, metastasis and/or invasion.^14-16 In preliminary clinical trials, AZD6244 has demonstrated activity in various tumors including colorectal cancer, lung cancer, acute myelogenous, breast cancer.^14,17-20 AZD6244 selectively targets cancer cells and thus the treatment-related toxicity is reported to be low.²¹ Some phase I/II clinical trials have reported AZD6244 to be relatively safe, efficacious and promising for solid tumors.^22-24 Several preliminary investigations suggest the efficacy of AZD6244 to be comparable to capecitabine with regards to disease-free/progression-free survival.²⁵ Currently, these pilot studies remain investigational.²⁶

Despite the preliminary promising results of AZD6244, development of drug resistance remains an ongoing problem. While several molecular markers such as BRAF, AKT, FOXO3a^20,21,27 have been implicated in potentiating this resistance, other markers need to be explored.

Metadherin (MTDH, also known as AEG-1 and Lyric) is a novel multifunctional oncogene which was first cloned by subtraction hybridization in 2002.²⁸ It has been found to be overexpressed in various cancers including squamous cell carcinoma of the esophagus, breast carcinomas, melanomas, hepatocellular carcinoma, and epithelial ovarian cancers.^29-31 Data suggest that MTDH plays an important role in promoting cell proliferation, migration, tumor metastasis and angiogenesis via the regulation of multiple molecular pathways including PI3K/AKT, NF-κB, MAPK, Wnt, vascular endothelial growth factor (VEGF), and the transcription factor family (FOXO1, FOXO3a etc.).^31-37 In breast cancer specifically, our group has previously demonstrated that greater than 40% of tumors overexpress MTDH, that overexpression of MTDH correlates with worse clinical outcomes,^32,38 that MTDH enhance the invasiveness of cells by inducing epithelial to mesenchymal transition (EMT),³⁹ and lastly, that MTDH has the potential to induce multiple drug resistance in breast cancer (doxorubicin, paclitaxel, cisplatin).⁴⁰ However, the mechanism of MTDH involvement in the treatment of AZD6244 in breast cancer has yet to be been explored. In this study, we utilized a triple negative breast cancer cell line that is insensitive to AZD6244^22,41 to demonstrate that knockdown MTDH can distinctly sensitize breast cancer cells to AZD6244 treatment. We also explored a potential mechanism that MTDH may affect the sensitivity to AZD6244: by upregulating the expression of FOXO3a and activating it by promoting translocation.

Results

Knockdown MTDH sensitizes MDA-MB-231 cells to AZD6244

To test the hypothesis that MTDH plays an important role in the sensitivity to AZD6244 in breast cancer, the short hairpin RNA (shRNA) targeting MTDH gene was designed and inserted into the pSUPER.retro.puro plasmid, then transfected into MDA-MB-231 cells. Stable cell lines were selected by puromysin, then MTDH expression was measured using RNA levels (real time PCR) and protein levels (western blot) as shown in Figure 1A. The 231-prpM cells demonstrated significantly less MTDH expression in both mRNA and protein levels compared with the control 231-prpn.

Figure 1. Knockdown of MTDH sensitizes MDA-MB-231 cells to AZD6244. (A) Relative MTDH mRNA and protein levels in the breast cancer cell line MDA-MB-231 transfected with prpn and prpM vector, respectively. Error bars represent means ± SD of triplicate measurements. (B) Cell viability was evaluated using the MTT assay after treated cells with various concentration of AZD6244 for 96 h. Marked difference of survival fraction was observed between 231-prpn and 231-prpM cells (p = 0.005). Data shown are the means ± SD of three independent experiments. (C and D) Percentages of G₀/G₁ cells of each treated sample were measured using flow cytometric analysis for PI staining for cell cycle after 24 h treatment with AZD6244 0.5uM while the cells without treatment as control. (Data represent mean ± SD and results are representative of three independent experiments, *p < 0.01 vs. respect control). (E and F) 231-prpn and 231-prpM cells were treated with AZD6244 10 μM for 96 h and subjected to sub-G₁ analysis using flow cytometric analysis with the cells without treatment as control. Cell death was measured by percentages of sub-G₁ cells. Data represent mean ± SD and results are representative of three independent experiments, *p < 0.01 vs. respect control.

Subsequently, the two selected cell lines were treated with various concentrations of AZD6244 for 96 h, and MTT was used to quantitate changes in viability. The observed changes in sensitivity for the cell lines with MTDH are shown in Figure 1B. While AZD6244 reduced the cell viability in a dose-dependent manner in both cell lines, the 231-prpM cells were significantly more sensitive to AZD6244 growth inhibition (IC₅₀ from 6.04 ± 0.08 μM in 231-prpn to 0.52 ± 0.04 μM in 231-prpM, p = 0.005).

MTDH knockdown enhanced the AZD6244 induced G₀/G₁ cell cycle arrest and cell apoptosis

To further validate the effect of MTDH on cell sensitivity to AZD6244, we tested whether knockdown MTDH sensitizes cell cycle arrest and apoptosis after exposure to AZD6244. Indeed, the reduced expression of MTDH led to a higher percentage of cells accumulating in G₀/G-phase (70.64–42.98 vs. 57.99–50.08%) (Fig. 1C and D) and more sub-G₁ phase (32.15 vs. 16.62%) (Fig. 1E and F). These results indicated that MTDH knockdown enhanced cells respond to AZD6244 in the G₀/G-phase arrest and promoted cell apoptosis.

MTDH knockdown increased expression of FOXO3a and promoted its nuclear translocation through regulating ERK1/2 but not AKT activity

To identify a potential mechanism of action, protein expression of ERK1/2, p-ERK1/2 was measured. The expression of AKT, p-AKT and FOXO3a were also tested with the rationale that expression levels and activation of AKT have been reported to be important in mediating the resistance to AZD6244⁴² and share with ERK1/2 the same downstream molecular-the transcription factor FOXO3a.⁴³ Furthermore, FOXO3a can be induced by AZD6244 and make cells more sensitive to this drug.²¹ These findings are shown in Figure 2A: MTDH knockdown (A) inhibited the activity of ERK1/2 (B) activated AKT and (C) upregulated the expression of FOXO3a. It has been reported that activate either ERK1/2 or AKT can make FOXO3a inactive and degradation via phosphorylation.^44,45 Based on these findings, we further postulated that the upregulation of FOXO3a was through the reduced activity of ERK.

Figure 2. MTDH knockdown increases expression of FOXO3a and promote its nuclear translocation. (A) The FOXO3a expression in protein level was examined by western blot, both ERK1/2 and AKT activity were measured by the level of p-ERK1/2 and p-AKT. (B) The expression of p-FOXO3a (Ser 294) was measured by western blot. The phosphorylation level of FOXO3a was measured by the ratio of p-FOXO3a/FOXO3a. (Data represent mean ± SD and results are representative of three independent experiments, *p < 0.01 vs. 231-prpn.) (C) The expression of FOXO3a in cytoplasma and nucleus was measured by western blot. (D and E) The efficiency of FOXO3a knockdown by siRNA in 231-prpn and 231-prpM cells was tested by western blot after transfected cells for 24 h. The changes of 231-prpM and 231-prpn cells sensitivity to AZD6244 was measured by MTT after treated cells for 96 h.

Previous study has shown that ERK interacts with and phosphorylates FOXO3a at Ser 294, Ser 344 and Ser 425 to promote its cytoplasmic translocation and degradation via MDM2.⁴⁴ To test our hypothesis, we measured the p-FOXO3a (Ser 294) expression. The results demonstrate that while MTDH knockdown did not change the expression level of p-FOXO3a, a reduction in the ratio between p-FOXO3a and total FOXO3a was observed (Fig. 2B). To assess whether MTDH knockdown activates FOXO3a via enhancment of its translocation, we tested the expression of FOXO3a in both nuclear and cytoplasma in 231-prpn and 231-prpM cells and found that the expression of FOXO3a was decreased in cytoplasm but increased in the nuclear after MTDH knockdown (Fig. 2C). These results indicated the enhanced expression and nuclear translocation of FOXO3a may be achieved by the inactivation of ERK1/2.

FOXO3a knockdown reverse the sensitivity to AZD6244 induced by MTDH knockdown

To demonstrate the role of FOXO3a in MTDH knockdown induced sensitivity to AZD6244, we utilized knockdown FOXO3a in both 231-prpn and 231-prpM cells using siRNA to test the knockdown efficiency by western blot. Additionally, we used MTT assay to measure the changes of sensitivity to AZD6244 with the negative siRNA transfected cells as control. As shown in Figure 2D, in 231-prpM cells, FOXO3a knockdown resulted in more cellular resistance to AZD6244 (p = 0.018), which was not observed in 231-prpn cells (Fig. 2E).

Discussion

Previous studies have suggested that AZD6244 is potent, selective and safe in various tumors but the emergence of resistance may limit its clinical applicability.^14,17-20 Understanding the mechanism(s) of drug-resistance may allow us to identify methods for overcoming the major limitation of this drug. Several studies have suggested that cell resistance to AZD6244 is associated with wild-type BRAF,²⁰ high level expression and activity of AKT,^27,42 reduced FOXO3a activity,²¹ and upregulation of Wnt pathway.⁴⁶ We contribute to the existing limited literature with data suggesting that the MTDH gene may also contribute to resistance in AZD6244.

MTDH is involved in regulating cell proliferation, migration, tumor metastasis and angiogenesis^32,33 in malignant tumors via multiple pathways including ERK1/2 and AKT pathways. Our group has previously demonstrated the association between MTDH and drug resistance,^31,32,47 and found preliminary data to suggest that MTDH may contribute to the drug resistance to AZD6244. In this study, we found MTDH knockdown can significantly sensitize MDA-MB-231 cells to AZD6244. As AZD6244 has been reported to induce cell cycle arrest and apoptosis²¹ we further demonstrated an increased cell cycle accumulation in G₀/G₁-phase and increased sub-G₁ rate in MTDH knockdown cells after treatment with AZD6244.

FOXO3a is a transcription factor which plays a crucial role in regulation of the cell cycle and cell apoptosis. Furthermore, FOXO3a has been reported to promote cell sensitivity to AZD6244.²¹ The activation of FOXO3a occurs via nuclear translocation. Cytoplasmic translocation or proteasomal degradation of FOXO3a is through phosphorylation that is regulated by ERK1/2, AKT or IKK activity in response to growth factor and insulin stimulation. All of the ERK1/2 and the AKT pathways are reported to be regulated by MTDH.^44,45,48

Our first hypothesis was that MTDH knockdown induced sensitivity to AZD6244 through FOXO3a activation. We tested our hypothesis by measuring the expression and activation change of the AKT, ERK1/2 and FOXO3a and found that knockdown MTDH in MDA-MB-231 can inactivate ERK1/2, activate AKT, upregulate and promote nuclear translocation of FOXO3a. Furthermore, we hypothesized that the increased expression of FOXO3a was induced by its enhanced stability via decreased ERK1/2 activity. Our results supported this hypothesis in that the decreased activity of ERK1/2 by knockdown MTDH did, in fact, reduce the phosphorylation level of FOXO3a at Ser 294 which is the specific phosphorylation site of FOXO3a interacting with ERK1/2. These findings suggest that MTDH knockdown not only increases expression of FOXO3a but also activates it by promoting its nuclear translocation which may occur through the MTDH/ERK1/2/FOXO3a pathway.

Lastly, we hypothesized that the activity of FOXO3a plays a crucial role in the sensitivity to AZD6244 induced by MTDH knockdown. Using siRNA targeted FOXO3a to inhibit its activity, we tested the changes of sensitivity to AZD6244 in both 231-prpn and 231-prpM cells. Our findings suggest that FOXO3a plays an important role in cells sensitivity to AZD6244 in MTDH knockdown cells 231-prpM but not in the 231-prpn cells, which express low levels of FOXO3a. These results indicate that the effect of FOXO3a in MTDH knockdown induced cell sensitivity to AZD6244 is related to MTDH. Whether the MTDH oncogene affects the cellular response to AZD6244 by additional mechanisms remains to be addressed.

In recent years, the identification of specific genes, proteins and biological molecular pathways that are associated with the development and progression of breast cancer have been identified which have ultimately become targets for therapy.^6,7 MTDH is an important oncogene in breast cancer which has been found to play a critical role in tumor progression and thus prognosis. In this study, we have identified MTDH as a potential novel target for drug resistance to AZD6244, a finding which has not been previously reported. Our findings suggest that regulation of MTDH pathways may provide a promising approach to sensitizing breast cancer cells to AZD6244.

Materials and Methods

Reagents

AZD6244 (Selleck Chemicals, S1008) was dissolved in dimethyl sulphoxide (DMSO, Sangon Biotech, 0231) to a final concentration of 50 mM and stored at -20°C. Anti-MTDH rabbit polyclone antibody (Invitrogen Carlsbad), rabbit anti-ERK1/2, p-ERK1/2, AKT, p-AKT, FOXO3a and p-FOXO3a (Ser 294) (Cell Signaling Technology), rabbit anti-Histone H3 (Beyotime Institute of Biotechnology), mouse anti-β-actin monoclone antibody (Sigma), and HRP-labeled secondary antibodies (KPL) were utilized.

Cell culture

The cell line MDA-MB-231 (ATCC) was grown in Dulbecco modified Eagle medium (Gibco-BRL, 12800-017) with 10% fetal bovine serum (Haoyang biological manufacture Co. Ltd), 100 U/ml penicillin and 100 ug/ml streptomycin at 37°C 5% CO₂ incubator.

siRNA and vector construction

The plasmid construction was performed as described previously.³² Briefly, the 19-nt sequence 5′ ATGAACCAGAATCAGTCAGC 3′ was used to generate MTDH shRNA. The 60-nt oligonucleotides were annealed and cloned into the HindIII and BglII sites of the pSUPER.retro.puro vetor which is also used as control and called prpn. The shRNA interference vetor called prpM was confirmed by sequencing. The small interfering RNA (siRNA) sequence CCUGUCACUGCAUAGUCGAtt for FOXO3a and a negative control (Shanghai Gene Pharma Co. Ltd) were utilized.

Transfection and expression of shRNA

For transfection Lipofectamine 2000 (Invitrogen, 11668-019) was used as per manufacturer’s instructions. The cells were plated at a density of 5 × 10⁴ cells/well, and the cells were washed twice with PBS the following day and transfection mixes added. The cells were incubated for 4 h at 37°C and 5% CO2. Subsequently, the transfection medium was replaced by the complete medium. After 24 h, the cells were plated for additional experimentation for transient transfection while for stable transfection cells were passaged at a 1:10 dilution into fresh growth medium. After 24 h, 0.5 μg/ml puromycin (Invitrogen) was added in order to select the stable cell lines. The empty prpn vector was used to establish the 231-prpn cell line while the shRNA interference vector prpM was used to generate the 231-prpM cell line.

Cytotoxicity assay

The sensitivity of drugs was measured by 3-(4, 5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide (MTT, Sigma, M2128). Cells were plated in 96-well culture plates at a density of 2.5 × 10³ cells/well. The next day, different concentrations of AZD6244 were added into 100 μl dilutions of the culture medium. The DMEM medium was utilized as the bank control while the cells without reagents were the negative control. After incubation for 96 h at 37°C, 5% CO2, 20 μl MTT were added to each well. Cells were incubated for another 4 h and DMSO were added 100ul/well to dissolve the formazan after removing the culture medium. The reduction of MTT was quantified by absorbance at a wavelength of 490 nm using Microplate Reader (Bio-Rad).

Western blot

Cells were washed with ice-cold PBS and lysed with ice-cold RIPA buffer (Shennengbocai) [1 × PBS, 1% NP40, 0.1% sodium dodecyl sulfate (SDS), 5 mM EDTA, 0.5% sodium deoxycholate] containing protein inhibitor cocktail (SIGMA) and phosphatase inhibitor sodium fluoride (NaF) and sodium vanadate (NaVO3). Nuclear and cytoplasmic extraction reagents (Beyotime Institute of Biotechnology) were used to extract nuclear proteins, which were then quantified by BCA Protein Assay Kit (Merck, 71285-3) and separated by 5–10% SDS-PAGE. These were transferred onto the PVDF membrane (Millipore), which were blocked in 1 × TBST with 5% skim milk for 1 h and subsequently incubated with the corresponding primary antibodies overnight at 4°C. The membranes were subsequently washed three times with TBST and incubated with secondary antibody for 1 h at room temperature. After washing three times in TBST, each protein was detected using an ECL system (Merck). The bands were quantified by densitometry and normalized to the appropriate loading controls and analyzed using the public domain Image J program.

Real-time RT-PCR

Total RNA was isolated using Trizol (Invitrogen, 15596-026) as per manufacturer’s protocol. RNAs were reverse transcripted by using PrimeScript RT reagent Kit (Takara). The resulting cDNA was used for quantitative realtime PCR on a StepOne Plus instrument from Applied Biosystems with SYBR green detection. Primers involved were the MTDH primers (forward 5′-AAATAGCCAGCCTATCAAGACTC-3′, reverse 5′-TTCAGACTTGGTCTGTGAAGGAG-3′) and the GAPDH primers (forward 5′-GGGCTGCTTTTAACTCTGGTAAAG-3′, reverse 5′-CCATGGGTGGAATCATATTGG-3′). StepOne Plus software was used to calculate crossing threshold (Ct) points from the fluorescence curves and the delta/delta-Ct method was applied to quantify the induction of mRNA as compared with the control sample.

Cell cycle analysis by flow cytometry

Cells were harvested by trypsin, washed by PBS and then stained with the buffer including 50 μg/ml propidium iodide (Sigma), for 30 min at room temperature. For fluorescence-activated cell sorting (FACS) analysis, data was collected using a FACSCalibur (BD Bioscience) flow cytometer. The cell-cycle distribution was evaluated by counting > 20,000 cells/samples.

Statistical analysis

All experiments were repeated at least three times independently. All data were presented as means ± SD of the mean and analyzed with Microsoft Excel analysis tools. Differences between individual groups were analyzed by paired t-test. P values of < 0.05 were considered statistically significant.

Acknowledgments

This project is supported by Program for New Century Excellent Talents in University, Key Project of Chinese Ministry of Education (No. 108080), National Natural Science Foundation of China (No. 30772133; No.81072150; No.81172529) and Independent Innovation Foundation of Shandong University (IIFSDU, No. 2009JQ007) to Y.Q.

Disclosure of Potential Conflicts of Interest

No potential conflicts of interest were disclosed.