Inhibition of STAT1 sensitizes renal cell carcinoma cells to radiotherapy and chemotherapy

Abstract

Renal cell carcinoma is resistant to chemotherapy and radiotherapy. STAT1 is overexpressed in human RCC tissue. Downregulation of STAT1 expression could significantly increase the radiosensitivity in RCC cell lines. To further investigate the function of STAT1 in RCC resistance to chemoradiotherapy, a stable STAT1 knockdown cell line was established. Knockdown of STAT1 led to significant growth suppression in vitro and in vivo. Inhibition of STAT1 sensitized 786-O cells to radiotherapy and Taxol treatment. Cells with low STAT1 expression accumulated more strongly in the G₂/M phase after treatment with chemotherapy and radiotherapy. The Human Cell Cycle and DNA Damage Signaling Pathway Real-time PCR arrays were performed and 3 genes upregulated and 16 genes downregulated after STAT1 knockdown were selected. Functional gene grouping showed that genes involved in the M phase, S phase and DNA replication did not differ between the two cell lines. G₁ phase related genes ANAPC2, CCNE1, CUL1 were downregulated, and G₂/M checkpoint genes p21, GADD45A and Rb were strongly reduced by STAT1 knockdown. DNA damage-related genes GADD45A, MAP2K6, were significantly downregulated. The results prove that overexpression of STAT1 in human RCC is associated with the chemoradioresistance. Targeting of STAT1 might be a potential strategy to sensitize RCC to chemotherapy and radiotherapy.

Keywords: :

• cell cycle
• chemoresistance
• DNA damage
• radioresistance
• renal cell carcinoma
• signal transducer and activator of transcription 1

Introduction

STATs (signal transducers and activators of transcription) are transcriptional factors and can be activated by various extracellular stimuli, including growth factors and cytokines.¹ When cytokines bind to an appropriate receptor, the signal cascade transduce to the cytoplasm and the Janus tyrosine kinase (Jak) family becomes activated, resulting in STAT phosphorylation. STATs can then dimerize and translocate to the nucleus. Once in the nucleus, the STATs bind to specific DNA response elements and promote transcription.^2,3 Different STATs are activated by specific cytokines for different functions. STAT1, the first discovered member of the STATs family, is the key effector of interferon (IFN)γ ανδ ΙΦΝ‴α/β signaling.⁴ STAT1 can form a homodimer or heterodimer with other family members. The target genes of STAT1 include caspase 3, 6, 8, Bcl-XL, FAS/FASL, p21waf1, c-myc and others.^1,5-7

As it is an important mediator of IFN signaling, the normal functions of STAT1 are mostly related to the biological effects of IFNs. STAT1 plays a critical role in cell death induced by various stimulating factors,⁵ and is known to be a tumor suppressor gene. It has been found to be inappropriately activated or even suffer a loss of expression in many type of human cancers, such as breast cancer, melanoma, leukemia, and lymphoma.⁸ In breast cancer cells, STAT1 activation in response to IFNγ, combined with the anti-cancer drug doxorubicin, has resulted in enhanced apoptosis.⁹

Recent research has found inconsistent data in some types of cancers. In cervical cancer, expression of STAT1 gene rose in CIN1/2, fell in CIN3/CIS, and then significantly rose in invasive cancers.^10,11 In a study of highly invasive and weakly invasive cell clones from a melanoma cell line, STAT1 was found to be strongly upregulated in the highly invasive cell clone.¹² Our previous study confirmed the overexpression of STAT1 in both renal cancer cell lines and renal cancer tissues. High STAT1 expression and activation were associated with a greater Fuhrman tumor grade or the presence of sarcomatoid features in RCC.¹³ STAT1 was also associated with tumor radioresistance and chemoresistance. In research into paired chemosensitive and chemoresistant cell lines, STAT1 was found to be closely correlated with chemoresistance.¹⁴ STAT1 overexpression was associated with decreased sensitivity to cisplatin in human ovarian cancer cell lines.¹⁵ In radioresistant cancer cells, STAT1 was significantly overexpressed. Upregulation of STAT1 expression in radiosensitive cells confers protection from radiation.^16,17

RCC is traditionally considered to be resistant to chemotherapy and radiotherapy.¹⁸ Patients with metastatic renal cancer have a median survival time of < 12 mo. Recent advances in immunotherapy, targeted therapy with small molecule kinase inhibitors, vascular endothelial antibodies, and combination treatment modalities have shown promising trends.¹⁹ We found overexpression of STAT1 in human clear cell and papillary RCC tissues. Downregulation of STAT1 expression by both fludarabine and siRNA significantly increased the radiosensitivity of RCC cell lines.¹³ Howerver, the exact mechanism of STAT1 in renal cancer is still not clear. In this study, we knocked down the expression of STAT1 in human RCC clear cell line 786-O, and explored the phenotype and molecular alteration on STAT1 knockdown. We studied the effect of STAT1 on chemosensitivity and radiosensitivity, and the possible molecular mechanism through which STAT1 affects the cell’s response.

Results

STAT1 knockdown in 786-O cells inhibited cell growth in vitro and in vivo

We knocked down the STAT1 expression in 786-O cells by RNAi technology. The expression plasmid was transfected into 786-O cells and selected with 5 μg/ml blasticidin S HCl for 2 weeks. The efficiency of STAT1 reduction was confirmed by western blot. The stable cell line expressing a reduced STAT-1 level was selected and designated as 786-O-XR-1. STAT1 expression was reduced by about 55% compared with the parental cells (Fig. 1A). The 786-O-XR-1 stable cell lines were maintained in 5 μg/ml blasticidin S HCl. Growth curves were then constructed by cell counting. The growth rate of 786-O-XR-1 cells was slower than that of 786-O cells (Fig. 1B). Cell cycle distribution was also examined by propidium iodide staining and analyzed by FACS. The percentage of cells in each phase had no significant difference between 786-O-XR-1 and 786-O (Fig. 1C). Then we subcutaneously injected an equal number of cells into nude mice. Tumor formation was seen in 80% (8/10) mice injected with 786-O but not in the mice injected with 786-O-XR-1 (Fig. 1D). The results indicated that reduced STAT1 expression slowed the growth rate of 786-O cells and completely inhibited tumor formation in nude mice.

Figure 1. Knockdown of STAT1 in renal 786-O cells inhibited cell growth in vitro and in vivo. (A) Expression of STAT1 in 786-O and 786-O-XR-1 cells. After transfection with pcDNA6.2-GW/EmGFPmiR, 786-O-XR-1 cells were selected by 5 μg/ml blasticidin S HCl pressure. Total cell proteins were extracted and subjected to SDS-PAGE and immunoblotted using antibody against STAT1. STAT1 protein in 786-O-XR-1 cells was about 45% of that of control cells. (B) Growth curve of 786-O and 786-O-XR-1 cells. Cells (1 × 10⁴) were seeded onto a 24-well plate and counted daily. (C) Cell cycle distribution of 786-O and 786-O-XR-1 cells. (D) Tumor formation in nude mice. Five nude mice were injected subcutaneously with 786-O and 786-O-XR-1 cells and were sacrificed 2 mo after injection. Similar results were observed in two independent experiments. The weights of the tumors were recorded and expressed as means ± SD.

Response of 786-O cells to chemotherapy and radiotherapy after STAT1 downregulation

RCC is resistant to both chemotherapy and radiotherapy. We have previously demonstrated that 786-O cells can be radiosensitized by inhibition of STAT1 signaling by fludarabine and STAT1 siRNA.¹³ Here, we examined the response to chemotherapy after STAT1 inhibition. 786-O-XR-1 and 786-O cells were treated with Taxol (Bristol-Myers Squibb Caribbean Co., USA), cisplatin (Qilu Pharma, China) or doxorubicin hydrochloride (Wanle Pharma, China), at different concentrations for 72 h. Cell viability was measured by MTT assay. With cisplatin and doxorubicin hydrochloride, 786-O-XR-1 and 786-O cells showed no differences in cell viability, but 786-O-XR-1 was more sensitive to Taxol than 786-O cells (Fig. 2). The results indicated that STAT1 downregulation could sensitize cells only to Taxol treatment, but had little effect on cisplatin and doxorubicin hydrochloride treatment.

Figure 2. Response of 786-O and 786-O-XR-1 cells to anti-cancer drugs. Cells were treated with anti-cancer drugs for 72 h. Cell viability was measured by MTT assay. (A) Cisplatin (PPD). (B) Doxorubicin hydrochloride (DOX). C. Taxol. All experiments were performed in triplicate and expressed as means ± SD.

We then analyzed the response of the cell cycle to chemotherapy and radiotherapy using propidium iodide staining and FACS. As previously reported, cells were blocked in the G₂/M phase and cell death occurred after X-ray radiation.²⁰ After STAT1 knockdown, upon X-ray radiation, a greater accumulation of 786-O-XR-1 cells was found in the G₂/M phase than was found in the control cells (Fig. 3A and 3D). Similar results were also seen in Taxol and doxorubicin hydrochloride treated 786-O-XR-1 cells (Fig. 3B, 3C and 3E). But in cells treated with cisplatin, the cell cycle distribution of 786-O-XR-1 and 786-O cells had no significant difference (Fig. 3C and 3E). Thus, downregulation of STAT1 in renal cancer cells pushed accumulation of more cells in the G₂/M phase after radiotherapy and chemotherapy.

Figure 3. Analysis of cell cycle progression of 786-O and 786-O-XR-1 cells treated with chemotherapy or radiotherapy. (A) Cells treated with X-ray radiation and cultured for 48 h. (B) Cells treated with Taxol for 24 h. (C) Cells treated with cisplatin (PPD) or doxorubicin hydrochloride (DOX) for 24 h. (D) Cell cycle distribution of 786-O and 786-O-XR-1 cells treated with X-ray radiation. E. Cell cycle distribution of 786-O and 786-O-XR-1 cells treated with anti-cancer drugs. Cells were harvested and stained by propidium iodide and analyzed by a flow cytometer. Data represent the results of three independent experiments.

Gene expression profile assay of 786-O and 786-O-XR

To investigate the molecular mechanism of STAT1 in radioresistance and chemoresistance, we performed a PCR array focusing on the cell cycle and DNA damage to study the different gene expression profile of STAT1 downregulation. Using filtering criteria of a 2-fold or greater fold-change in expression, 3 genes upregulated and 16 genes downregulated upon STAT1 knockdown were selected (Fig. 4A). Alterations in the level of protein expression were detected by Western Blotting (Fig. 4B and 4C). Functional gene grouping showed that genes involved in the M phase, S phase and DNA replication did not differ between the two cell lines. G₁ phase related genes ANAPC2, CCNE1, CUL1 were downregulated, and G₂/M checkpoint genes p21, GADD45A and Rb were strongly reduced by STAT1 knockdown. DNA damage-related genes GADD45A, MAP2K6, were significantly downregulated. The gene p21(CDKN1A) is a well-known target gene of STAT1, and STAT1 activation is associated with upregulation of p21.⁷ In our system, p21 RNA was downregulated more than 10-fold, and the protein expression level was also significantly lower in 786-O-XR-1 cells than in control 786-O cells. By PCR array, we screened the DNA damage and cell cycle related genes affected by STAT1. These genes may contribute to the radioresistance and chemoresistance of renal cancer cells.

Figure 4. Alteration of gene expression by STAT1 knockdown. (A) Quantitative comparison of transcript levels in786-O-XR-1 and 786-O cells using the RT² Profiler™ PCR Array (SABiosciences). (B) western blot analysis showed that the levels of protein expression altered in some of the genes. (C) Protein expression normalized to β-actin.

Discussion

Many patients with RCC are already in a very advanced stage of the disease at diagnosis, and need to be treated with chemotherapy and radiotherapy. But RCC is resistant to this treatment. Patients with metastatic RCC have a median survival time of < 12 mo,¹⁹ and so it is imperative to understand the molecular mechanism of resistance and determine which genes prevent or interfere with resistance. STAT1 has been regarded as a key modulator of cell death.⁵ The exact role of STAT1 in different types of cancer tissue is still controversial. STAT1 has been regarded as a tumor suppressor gene in some cancers because of its inappropriate activation and even loss of expression in malignant cells.⁸ Our previous study found STAT1 overexpression in human renal carcinoma tissues and RCC cell lines. Inhibition of STAT1 signaling by fludarabine or siRNA might sensitize RCC cell lines to radiotherapy¹³; Similar results have been obtained by other groups.^16,21 To further investigate the function of STAT1 in renal cancer cells, we constructed a renal cell line with STAT1 knockdown. After knockdown of STAT1, the renal cancer cells grew more slowly and lost their potential to form tumors in nude mice. STAT1 may have an important role in cell growth and tumor formation in nude mice. Pitroda et al. knocked down STAT1 in humans in the SCC61 human squamous cell carcinoma cell line, which led to a significant suppression of tumor volume relative to STAT1 wild-type tumors.²²

Since STAT1 was associated with radioresistance in renal cancer cells, we then used the model to examine whether STAT1 was involved in the chemoresistance of renal cancer. We treated the 786-O-XR-1 cells with the commonly used anti-cancer drugs: Taxol, cisplatin and doxorubicin hydrochloride. Unexpectedly, STAT1 knockdown sensitized 786-O only to Taxol treatment, but had no significant effect on cisplatin and doxorubicin hydrochloride.. We then analyzed the cell cycle distribution of cells in a number of ways. Although by completely different mechanisms, X-ray radiation and Taxol treatment both blocked cells in the G₂/M phase, then progressed to cell death. STAT1 could facilitate cells entering the G₂/M phase and postpone or prevent cells from leaving. Our data indicated that STAT1 might participate in chemoresistance/radioresistance through its function in the cell cycle progression. For cisplatin and doxorubicin hydrochloride, they mainly inhibited the biosynthesis of DNA, RNA and protein.

To test our hypothesis, we performed a PCR array focusing on cell cycle and DNA damage to study the expression profile after STAT1 downregulation. Using filtering criteria of a 2-fold or greater fold-change in expression, six genes upregulated, and 20 genes downregulated, upon STAT1 knockdown were selected. By functional gene grouping, we found that there were no differences in the two cell lines for genes involved in the M phase, S phase and DNA replication. G₁-phase related genes ANAPC2, CCNE1, CUL1 were downregulated in 786-O-XR-1 cells. APC2 (ANAPC2) and CUL1 form part of the anaphase-promoting complex (APC), which is responsible for the metaphase to anaphase transition and the exit from mitosis.²³ So, STAT1 knockdown might prevent cells from leaving mitosis by inhibiting the function of the anaphase-promoting complex. On the other hand, G₂/M checkpoint genes p21, GADD45A and Rb were strongly reduced by STAT1 knockdown. These genes mediate sustained G₂/M arrest and delay cell cycle progression in order to allow additional time for repair of DNA damage.^24,25 Based on this principle, STAT1 knockdown would promote the passage of cells through the G₂/M checkpoint quickly and thus cells would have insufficient time to complete DNA repair. So, cells accumulating in the G₂/M phase were not blocked at the G₂/M checkpoint. They passed the checkpoint quickly and were blocked in the transition from metaphase to anaphase, and then died. Townsend et al. reported that STAT-1-deficient cells had defects both in the intra-S-phase and G₂/M checkpoints in response to DNA damage owing to defective Chk2-T68, NBS1-S343 and ATM-S1981 phosphorylation.²⁶ The inconsistency could be explained by the different cell types, but the most important difference was still STAT1 itself. The cell model used by Townsend et al. was STAT-1^−/− mouse embryonic fibroblasts,²⁷ which were completely STAT1 defective. In our experiment STAT1 expression in human RCC cells was just knocked down, but STAT1 protein was still detectable.

Of the genes associated with DNA damage, GADD45A and MAP2K6 were significantly downregulated in 786-O-XR-1 cells. MAP2K6 (MAPKK6, MEK6) functions as a mitogen-activated protein (MAP) kinase kinase, and phosphorylates and activates p38 MAP kinase.^28,29 p38 was reported to have an essential function in DNA repair.³⁰ So the reduction of MAP2K6 would restrict its activation of the target protein p38 MAP kinase, and consequently disturb the DNA repair.

STAT1 is a transcriptional factor activating many target genes, such as p21, Bcl-XL, caspase,⁵ and suppressing skp2.³¹ The STAT1 pathway participates in many physiological processes, including cell growth, proliferation, apoptosis, and functions of the immune system. STAT1 is regarded as a tumor suppressor.⁸ But its role in chemoresistance and radioresistance seemed to be dependent not only on its transcription activity. Pitroda et al. explored the STAT1-dependent expression of energy metabolic pathways and its relation with radioresistance.²² They found, as in our study, that most resistance-related genes were not the typical target genes of STAT1. The molecular mechanism of STAT1 regulation of genes needs further investigation.

Our results proved that overexpression of STAT1 in human RCC was associated with chemoradioresistance. Targeting of STAT1 might be a potential strategy to sensitize RCC to chemotherapy and radiotherapy.

Materials and Methods

Cell culture and construction of STAT1 knockdown cell line

The human RCC clear cell line (CRL-1932 [786-O]) was obtained from the American Type Tissue Collection and cultured in RPMI-1640 supplemented with 10% fetal bovine serum at 37°C in a humidified 5% CO₂ atmosphere. STAT1 knockdown was achieved by RNA interference. The BLOCK-iT™ Pol II miR RNAi Technology was provided by Invitrogen Service, China. Briefly, oligo F: TGCTGAATACAGGCGCTCTGCTGTCTGTTTTGGCCACTGACTGACAGACAGCAGCGCCCTGTATT; Oligo R: CCTCAATACAGGCGCTGCTGTCTGTCAGTCAGTGGCCAAAACAGACAGCAGAGCGCCTGTATTC were cloned into pcDNA6.2-GW/EmGFPmiR using a BLOCK-iT™ Pol II miR RNAi expression vector kit with EmGFP (Invitrogen, Cat: K4936–00). The expression plasmid was transfected into 786-O cells and selected with 5 μg/ml blasticidin S HCl (Invitrogen, Cat: 210–01) for 2 weeks. The stable cell line expressing a reduced STAT-1 level was designated as 786-O-XR-1.

Viability assay

To determine the effect of STAT1 on chemotherapy, cells were treated with different types of anti-cancer drugs for 72 h, then the medium was aspirated, and 20 μL of MTT (5 mg/mL) was added to the cells. After 4 h of incubation (37°C, 5% CO₂), the media were aspirated and 150 μL of dimethyl sulfoxide was added. The plates were placed on a shaking table at room temperature for 10 min. The cells were then measured by a microplate reader (Bio-Rad, Hercules, CA, USA) at a wavelength of 570 nm.

Cell cycle assay

Cells were harvested 24 or 48 h after treatment, washed in cold sterile phosphate-buffered saline and fixed with 70% ethanol for 1 h. Cells were stained with propidium iodide then underwent flow cytometric analysis (Becton-Dickinson, Franklin Lakes, NJ, USA).

PCR array assay

The expression profiles of 786-O and 786-O-XR-1 were analyzed using an RT² Profiler™ PCR array human cell cycle (PAHS-020A) and HUMAN DNA damage signaling pathway (PAHS-029A) (SABiosciences, CA, USA) by KangChen Bio-tech Inc., Shanghai, China. Total RNA was isolated from the 786-O and 786-O-XR-1 cells by using the TRIZOL reagent (Invitrogen, cat:15596026) and RNeasy MinElute Cleanup kit (Qiagen, cat:74204). The concentration and purity of RNA were determined by the NanoDrop ND-1000. cDNA was synthesized from 1.5 μg of RNA using a SuperScript III reverse transcriptase(Invitrogen, cat: 18080044). PCR was performed with the RT² Profiler™ PCR array system according to the manufacturer’s instructions and the data shown represent the average of two replicates. The expression levels of the mRNA were normalized using the expression of GAPDH and ACTB. The p values were calculated based on a Student’s t-test of the replicate 2^(- Delta Ct) values for each gene in the control group and treatment groups, and p values less than 0.05 were considered statistically significant. The results were confirmed by RT-PCR or Western Blot.

Western Blot

Cells were harvested and lysed in RIPA buffer, and equal amounts of protein were separated by SDS-PAGE and transferred to an EC membrane. Membranes were incubated with primary antibody at 4°C overnight, washed with 0.05% Tween 20 in Tris-buffered saline) and incubated with horseradish peroxidase conjugated secondary antibody (Zhongshan, Beijing, China) for 1 h at room temperature and developed with the Luminal Detection System (Santa Cruz, CA, USA). Antibodies against STAT-1 (cat# 9175, Cell Signaling) were purchased from Cell Signaling, Inc. Anti-β-actin (Sigma, cat:A5441) antibody was obtained from Sigma.

Tumor growth in nude mice

Equal numbers (2 × 10⁶) of 786-O and 786-O-XR-1 cells were harvested and subcutaneously injected into the Balb/C nude mice. The mice were kept in pathogen-free environments. After 2 mo, mice were sacrificed and the weights of tumors were measured at the end of the experiment. This experiment was repeated twice.

Statistical analysis

Data were expressed as the means of three different experiments ± SD. The results were analyzed by Student’s t-test and p < 0.05 was considered statistically significant.

Abbreviations:
IFN	=	interferon
RCC	=	renal cell carcinoma
STAT1	=	signal transducer and activator of transcription 1

Disclosure of Potential Conflicts of Interest

No potential conflicts of interest were disclosed.

Acknowledgments

This work was supported by National Natural Science Foundation (30800280, 81021061), and the Scientific Research Foundation for the Returned Overseas Chinese Scholars, State Education Ministry, P.R. China.