Distinct salt-dependent effects impair Fremyella diplosiphon pigmentation and cellular shape

Abstract

Salt impairs cellular morphology and photosynthetic pigment accumulation in the cyanobacterium Fremyella diplosiphon. Recent findings indicated that the impact of salt on cellular morphology was attributable to salt-associated effects on osmotic regulation, as the impact on morphology was reversible when cells were treated with an osmoticum in the presence of salt. The impact of salt on photosynthetic pigment accumulation was associated with ionic effects of salt on the cells, as pigment levels remained low when salt-treated cells were incubated together with an osmoticum or an antioxidant, the latter to mitigate the impact of a salt-associated accumulation of reactive oxygen species. Here, we provide evidence that the transcripts for genes encoding the phycobiliproteins are not reduced in the presence of salt. These results suggest that the negative impact of salt-mediated changes on pigment accumulation occurs post-transcriptionally. A greater understanding of the mechanisms which impact growth of strains such as F. diplosiphon, which harbor pigments that allow low-light and shade-tolerated growth, may facilitate the development or adaptation of such strains as useful for remediation of salt-impacted soils or biofuel production.

Keywords: :

• cellular morphology
• cyanobacteria
• osmotic stress
• oxidative stress
• phycobiliprotein
• reactive oxygen species
• salinity

Introduction

Increased salinity of water and soils negatively impacts the productivity of photosynthetic organisms.¹ Salinization is promoted by a number of factors, including human use of agricultural fertilizers,² road salts³ and other environmental factors, including drought and global temperature shifts.⁴ As interest develops in using non-arable or brackish environments for growing bioenergy strains for the potential production of biofuels, it will be advantageous to use strains that can grow in a wide range of habitats, including those that are tolerant to low light and shade. Cyanobacteria and algae are becoming increasingly viewed as viable sources for producing biofuels for reasons that include their suitability for growth in saline-rich environments.⁵ Using cyanobacterial or algal strains that also support growth in light-limited environments, including those strains that produce pigments such as phycoerythrin (PE) that allow growth in low light and shaded habitats,⁶ would also likely increase their biofuel production capacity. Additionally, there has been interest in the use of salt-tolerant cyanobacterial strains for the remediation of salt-impacted soils.^7-10

We decided to investigate the impacts of salinity on the growth and development of the freshwater cyanobacterium Fremyella diplosiphon, for which many studies have been conducted regarding the ability of the organism to adapt its growth dynamically to a range of conditions, including different colors and intensity of light.^11-17 In recent experiments, we observed that salt stress alters growth, pigmentation and cellular morphology in F. diplosiphon.¹⁸ In response to salt stress under both green light (GL) and red light (RL) conditions, photosynthetic pigment levels are reduced significantly and the morphology of cells are enlarged, indicative of stress.¹⁸ Notably, an increased cell size in the presence of salt has been documented for other cyanobacteria.^19,20 The salt-induced defect in morphology in F. diplosiphon is reversed to normal GL- and RL-specific cellular morphology when the osmoticum glycine betaine (GB) was added to the growth medium in the presence of salt.¹⁸ However, GB was unable to restore the growth and pigmentation phenotypes to a level similar to that of control samples lacking salt, suggesting that morphological defects are induced by reversible osmotic effects of salt on cells, whereas pigmentation defects are caused by irreversible ionic toxicity caused by salt.¹⁸

The impact of GB on salt-induced restoration of morphology in F. diplosiophon is attributed to cellular uptake of GB and the resultant restoration of osmotic pressure in the cell as a GB transport system is recognizable in the genome of F. diplosiphon (GenBank KC788749) and the genes are expressed as determined by RNA sequencing analyses.¹⁸ The accumulation of phycobiliproteins (PBPs) and chlorophyll a (chla) were negatively impacted in F. diplosiphon in the presence of salt and this response was attributed to ionic imbalances as GB treatment or treatment with ascorbic acid (AA) to reverse oxidative stress did not restore pigment levels.¹⁸ Here, we report on our complementary investigation which suggests that the impact of salt on PBP accumulation likely occurs at the post-transcriptional level.

Results

Salt does not reduce PBP gene transcript accumulation in F. diplosiphon

Once it became clear that GB could reverse the effect of salt on cellular morphology but had no major effect on restoring PBP concentrations,¹⁸ we further investigated the effect of salt on transcript levels of genes encoding the α and β-subunits of PE (i.e., cpeBA) and inducible PC (i.e., cpcB2A2) under GL and RL using RT-PCR. The presence of salt did not significantly reduce transcript levels of genes encoding α and β-subunits of PE under GL (Fig. 1). However, under RL these cpeB and cpeA transcripts were low in the absence of salt as expected,^21,22 and were not detected in the presence of salt (Fig. 1). Likewise, salt did not impair accumulation of the transcripts of both cpcB2 and cpcA2 under RL, compared to control samples lacking salt (Fig. 1).

Figure 1. Accumulation of phycobiliprotein gene transcripts in cells grown with or without sodium chloride (NaCl) salt under green light (GL) or red light (RL). RT-PCR analyses of the expression of cpeA, cpeB, cpcA2 and cpcB2 in Fremyella diplosiphon grown with (200 mM) or without (0 mM) NaCl under GL or RL. The transcript level of the orf10B gene was used as an internal control for each sample. (A) Representative agarose gel images and (B) average transcript levels relative to orf10B (± SD) calculated using densitometry measurements of three independent biological replicates. Identical letters over bars represent a homogeneous mean group (p > 0.05) within the bars for a single gene.

Discussion

In F. diplosiphon, a reduction in PC and PE content was found to be regulated at a post-transcriptional or translational level because salt addition to growth media did not impose any negative effect on accumulation of transcripts for genes encoding PC and PE monomers. Further investigation is required to understand how PC and PE are regulated post-transcriptionally or at the protein level in the presence of salt and how osmotic stress specifically may affect the cytoskeleton to alter cellular morphology under these conditions in F. diplosiphon.

Impacts of salt on growth and morphology of a range of other cyanobacteria and bacteria have been reported. The growth of the halotolerant cyanobacterium Aphanothece halophytica was reduced and bigger cell size was observed in the presence of > 0.5 M salt in the growth medium.²⁰ Growth was also reduced and a bigger cell size observed for the diazotrophic cyanobacterium Anabaena cylindrica.¹⁹ Gram-negative, sulfate-reducing bacterium Desulfovibrio vulgaris exhibited elongated cell size by 5-fold in the presence of 250 mM NaCl.²³ However, the addition of GB was found to efficiently alleviate the morphological defects in this bacterium,²³ similar to what we observed for F. diplosiphon.¹⁸ Reduced growth and larger cell shape with shorter interpeptide bridges in peptidoglycan were induced by 2.5 M NaCl in the Gram-positive bacterium Staphylococcus aureus; however, the presence of GB in the growth medium successfully reverted back to normal cell size and interpeptide peptidoglycon structure similar to control cells grown in the absence of salt.²⁴ These researchers concluded that high ionic strength is responsible for increased cell volume and altered shape.²⁴ The high osmolarity caused by NaCl or KCl inhibited cell division and resulted in the larger shape of Escherichia coli; however, addition of GB was found to restore DNA synthesis, cell division and normal cellular morphology.²⁵ All of these results, together with our prior recognition of the ability of salt to alter F. diplosiphon cell shape in a manner that can be reversed by GB,¹⁸ suggest specific salt-associated disruptions in ionic strength or osmolarity that impair apposite regulation of cellular morphology. However, the mechanism is distinct from salt-mediated reduction in photosynthetic pigmentation and/or growth that is not GB-reversible, nor mediated by transcriptional downregulation of the phycobiliprotein genes in F. diplosiphon, the latter reported here.

Materials and Methods

Experimental organism and growth conditions

Wild-type pigmentation strain SF33²⁶ of F. diplosiphon was used in this study. Cells were grown in autoclaved BG-11 medium (Fluka) containing 10 mM HEPES (hereafter BG-11/HEPES) at pH 8.0 with or without 200 mM sodium chloride salt (NaCl) under continuous white fluorescent light (WL,:15 μmol m⁻² s⁻¹). WL-grown cultures in exponential phase were diluted to an initial OD₇₅₀ of 0.2 and transferred to either GL or RL at: 15 μmol m⁻² s⁻¹ at 28°C with continuous shaking at ~175 rpm. GL and RL sources were those reported earlier.¹³

Total RNA extraction and RT-PCR analysis

Once the OD₇₅₀ reached more than 0.7 for all treatments, cultures were adjusted to an OD₇₅₀ of ~0.7. RNA extraction was performed using Trizol reagent (1 ml) after overnight growth, as previously described.²⁷ Total RNA was treated to remove contaminating genomic DNA using a TURBO DNA-free kit (Ambion) according to the manufacturer’s instructions for rigorous DNase treatment in a 100 µl reaction volume. Following DNase treatment, a second Trizol extraction was performed to improve the quality of total RNA. Trizol (200 µl) and chloroform (40 µl) were added to the DNase-treated samples and incubated for 3 min after short vortexing. After centrifugation at 13,000 × g for 15 min at 4°C, the top colorless aqueous phase (200 µl) was transferred into a new Eppendorf tubes, followed by the addition of isopropanol (168 µl), with brief vortexing. After incubation for 15 min at room temperature, samples were centrifuged at 13,000 × g for 8 min and supernatant was discarded. Thereafter, the pellet was washed once with 1 ml of 70% ethanol and dried for 5 min at room temperature to remove the residual ethanol. Finally, the pellet was dissolved in RNase-free water and the quality and quantity of RNA determined spectrophotometrically by the A₂₆₀/A₂₈₀ ratio and assessed using agarose gel electrophoresis. Total RNA (0.5 µg) was reverse transcribed using random primers in a 20 µl reaction mixture using a Promega reverse transcription (RT) kit. No-RT reactions were also performed for all treatments where reverse transcriptase enzyme was not added to the RT reaction mixture. After RT, 180 µl of H₂O was added to the mixture and 2 µl of it was used in conventional RT-PCR using GoTaq Green master mix (Promega) with primer sets designed for cpeA, cpeB, cpcA2, cpcB2 and internal control gene orf10B (for primer sequences see Table 1). Orf10B was used as an internal control as this region was shown to be constantly expressed under GL and RL in a microarray study in F. diplosiphon.²⁸ PCR was performed using the following parameters: denaturation at 95°C for 1 min, then 30 (cpeA, cpeB, cpcA2, cpcB2) or 37 (orf10B) cycles of 95°C for 30 sec, annealing at the indicated temperature (Table 1) for 30 sec and extension at 68°C for 30 sec, followed by an additional cycle of 68°C for 10 min, ending with a hold at 4°C. The PCR products were analyzed on a 0.8% agarose gel and imaged using Quantity One 1-D Software (Bio-Rad).

Table 1. Sequence of primers used in this study

Primer	Sequence (5′-3′)	Annealing temperature (°C)
cpeA for cpeA rev	GCAACCGAAGCTTACAACG GCAGTAGGCAAGCCTAAAGC	51
cpcA2 for cpcA2 rev	GAGGGCGTAGCTACCGC CGTACCAGCTGGGAGACAG	53
cpeB for cpeB rev	ATGCTGTAGCTGGAATGATCTG CTGGGAGTGTCTTGAATGTGA	56
cpcB2 for cpcB2 rev	TAGAGGCGCATACATTAGCG GAACGCCTAATGCTTGATATGTTT	55
orf10B for orf10B rev	ATGGACACTACAGATAATTCCC TCATACATCAGAACGAAGGG	54

Abbreviations:
AP	=	allophycocyanin
chla	=	chlorophyll a
GL	=	green light
PBP	=	phycobiliprotein
PBS	=	phycobilisomes
PC	=	phycocyanin
PE	=	phycoerythrin
RL	=	red light
ROS	=	reactive oxygen species
WT	=	wild type

Acknowledgments

This research was supported by the US Department of Energy (Chemical Sciences, Geosciences and Biosciences Division, Office of Basic Energy Sciences, Office of Science, grant no. DE-FG02-91ER20021 to B.L.M.). Support for Shailendra P. Singh was from a CAREER award from the National Science Foundation (grant no. MCB-0643516 to B.L.M.). We thank Britney Robinson, for whom funding was from the National Science Foundation (grant no. MCB-0919100 to B.L.M.) and Haley Miller, for whom funding was provided by the Professorial Assistantship Program of the Honors College at Michigan State University, for technical assistance. We also thank Jin Chen and Pingsha Hu for assistance with analyzing RNA sequencing data.

Disclosure of Potential Conflicts of Interest

No potential conflicts of interest were disclosed.