New silver nanoparticles induce apoptosis-like process in E. coli and interfere with mammalian copper metabolism

Abstract

Silver nanoparticles (SNPs) are new functional materials that are widely used in biomedical and industrial technologies. Two main features that make SNPs valuable are their strong antibacterial effects and low toxicity to eukaryotes. In this study, SNPs were synthesized using a modified method of reducing the metal ions to their atomic state followed by crystallization. SNPs were characterized by UV/vis spectroscopy, X-ray diffractometry, atomic force microscopy, and transmission electron microscopy (TEM). The SNPs were spherically shaped with an average linear dimension of 20 nm. In aqueous solution, the SNPs were beige-yellow in color, and they formed a black color in bacteria-rich growth media. The toxicity and bioavailability of the SNPs were tested using Escherichia coli cells and C57Bl/6 mice. Although the SNPs displayed bactericidal activity, an E. coli cell strain transformed with an expression plasmid carrying a human CTR1 ectodomain with three motives that bind Cu(II), Cu(I), and Ag(I) demonstrated increased resistance to treatment with SNPs. TEM showed that the SNPs were absorbed by the E. coli cell, and flow cytometry showed that the SNPs induced apoptosis-like death. In mice treated with SNPs (daily intraperitoneal injection of 10 μg SNPs/g body weight over 4 days), the ceruloplasmin (Cp) oxidase activity in the blood serum decreased. However, level of Cp gene expression, the relative contents of the Cp protein in the Golgi complex and in the serum did not change. Treatment with SNPs did not influence the activity of superoxide dismutase 1 in the liver and had no apparent toxic effects in mice. These findings expand the scope of application for the use of new SNPs. The data are discussed in a paradigm, in which the effects of SNPs are caused by the interference of silver ions with copper metabolism.

Keywords:

• silver nanoparticles
• bioavailability
• apoptosis-like death
• mammalian copper metabolism
• copper status

Supplementary material

Figure S1 Description of Escherichia coli cells expressing metal-binding fragment of human CTR1.

Notes: Total RNA fraction was extracted from cultured HepG2 cells and used as template for cDNA synthesis. A 198 bp fragment of Slc31a1 gene, corresponding to extracellular N-terminal domain (ectodomain) of human CTR1 (hNdCTR1), was amplified by PCR from the cDNA, using forward (5′cagggatccgatcattcccaccatatggggatg3′) and reverse (5′cagctcgagtccagctgtattgatcacca3′) primers (Synthol, Moscow, Russia). The purified fragment (GeneJET PCR Purification Kit; Thermo Fisher Scientific, Pittsburgh, PA, USA) was then digested with the restriction enzymes BamH I and Xho I (New England Biolabs, Beverly, MA, USA) and cloned into glutathione-S-transferase (GST) gene fusion plasmid vector pGEX-4T-1 (Addgene, Amersham Biosciences, Buckinghamshire, UK); the resulting plasmid was named pNdCTR1. E. coli strain BL21 (DE3)/pNdCTR1 was obtained by chemical transformation (TransformAid™; Thermo Scientific) of bacteria. Plasmids were isolated using the alkaline method set GeneJET Plasmid Miniprep Kit (Thermo Scientific). The correctness of DNA insert was verified by restriction analysis and direct sequencing. (A) Primary structure of the human CTR1 N-terminal extracellular domain (66 amino acid residues) cloned in strain BL21 (DE3)/pNdCTR1 E. coli cells. Arabic numerals show Cu(I)/Ag(I)-binding motifs of the ectodomain. (B) Schema of plasmid carrying CTR1 ectodomain. NdCTR1 represents the cloned 198 bp fragment of SLC31A1 gene corresponding to extracellular N-terminal domain of human CTR1 protein. *Primary nucleotide structure of NdCTR1. (C) NdCTR1 expression in E. coli. Cells were induced with optimum concentration of IPTG (0.5 mM) during 3.5 h; crude cell SDS extracts were analyzed by PAGE. Left: M, molecular weight protein markers; 1, empty plasmid (GST expressed only); 2, 1BL21(DE3)/pNdCTR1 cells (fusion GST + NdCTR1). Gel was stained with Coomassie R250. Right (top): PAGE of E. coli BL21 (DE3)/pNdCTR1 crude SDS-extracts; 1, 3, and 5 – without IPTG induction; 2, 4, and 6 – with IPTG induction during 0, 1.5, and 3.5 h, respectively. Below: Immunoblotting the same samples with antibodies to CTR1 15-mer (¹⁷T … H³¹) peptide that was synthesized and conjugated with hemocyanin; the conjugates were then used to immunize rabbits. To test the specificity of the obtained antibodies, conjugates of the peptide with succinylated bovine serum albumin were used.

Abbreviations: CTR1, Copper transporter 1; PCR, polymerase chain reaction; GST, glutathione-S-transferase; GST-NdCTR1, glutathione-S-transferase-N-terminal domain of CTR1; pNdCTR1, pGEX-4T-1 expression vector containing gene for NdCTR1; NdCTR1, N-terminal domain of CTR1; BL21 (DE3)/pGEX-4T-1, E. coli strain synthesizing GST; BL21 (DE3)/pNdCTR1, E. coli strain synthesizing GST-NdCTR1; IPTG, isopropyl β-D-1-thiogalactopyranoside; Ptac, promoter; Amp^r, β-lactamase gene, responsible for resistance to ampicillin; SDS, sodium dodecyl sulfate; PAGE, polyacrylamide gel electrophoresis.

Acknowledgments

This work was supported by Russian Foundation for Basic Research grants (15-04-06770-a and 16-34-60219) and by grants from the Ministry of Education and Science of Russian Federation provision N 220 (14.B25.31.0011 and 6.1278.2014/K). The TEM characterizations were performed using equipment owned by the Joint Research Center “Material science and characterization in advanced technology” (Ioffe Institute, St Petersburg, Russia).

Disclosure

The authors report no conflicts of interest in this work.