LncRNA DHRS4-AS1 ameliorates hepatocellular carcinoma by suppressing proliferation and promoting apoptosis via miR-522-3p/SOCS5 axis

Figures & data

Table 1. The sequences used in this study

Name	Sequences
DHRS4-AS1 forward primer	5ʹ‑GGAGGCTGAGGCAGGAGAAT‑3’
DHRS4-AS1 reverse primer	5ʹ‑GCTAGTCTGGTCACCTCTGGAT‑3’
miR-522-3p forward primer	5ʹ‑CGCGAAAATGGTTCCCTTTA‑3’
miR-522-3p reverse primer	5ʹ‑AGTGCAGGGTCCGAGGTATT‑3’
SOCS5 forward primer	5ʹ‑GTGCCACAGAAATCCCTCAAA‑3’
SOCS5 reverse primer	5ʹ‑TCTCTTCGTGCAAGTCTTGTTC-3’
U6 forward primer	5ʹ-CTCGCTTCGGCAGCACA‐3’
U6 reverse primer	5ʹ-GGATGGTGATGGTTTGGTAG‐3’
GAPDH forward primer	5ʹ‐CTCGCTTCGGCAGCACA‐3’
GAPDH reverse primer	5ʹ-AACGCTTCACGAATTTGCGT‐3’
sh-DHRS4-AS1	5ʹ-GAACTGTACTCTTACTCGAGTAAGAGTACAGTTCTGTC CTTTTTT‐3’
miR-522-3p mimics	5ʹ-TCTCAGGCTGTGTCCCTCTAGAGGGAAGCGCTTTCTG TTGTCTGAAAGAAAAGAAAATGGTTCCCTTTAGAGTGTTACGCTTTGAGA‐3’
miR-522-3p inhibitor	5ʹ-CTCTAGAGGGAAGCGCTTTCTG‐3’
si-SOCS5	5ʹ-GATAATGATTCTTGTGTTACTCGAGTAACACAAGAATC ATTATCTTTTTT‐3’

Table 2. Correlation of DHRS4-AS1 expression with clinicopathological characteristics in HCC patients

characteristic	case	DHRS4-AS1 expression		P value
		low	high
All case	60	30	30
Age (years)				0.436
<60	27	12	15
≥60	33	18	15
Gender				0.787
Female	21	11	10
Male	39	19	20
Liver cirrhosis				0.197
No	12	4	8
Yes	48	26	22
HBsAg status				0.592
Negative	22	12	10
Positive	38	18	20
AFP (ng/ml)				0.405
≤ 20	19	11	8
> 20	41	19	22
Tumor size (cm)				0.020*
≤ 5	44	18	26
> 5	16	12	4
Tumor multiplicity				0.426
Single	37	20	17
Multiple	23	10	13
Edmondson grade				0.436
I–II	33	15	18
III–IV	27	15	12
TNM stage				0.045*
I–II	43	18	25
III–IV	17	12	5

Figure 1. LncRNA DHRS4-AS1 was in low expression in HCC tissues and cell lines. (a) DHRS4-AS1 was predicted in descent expression level in HCC via TCGA database. (b) QRT-PCR exhibited significant reduction of DHRS4-AS1 expression in HCC tissues. (c) The level of DHRS4-AS1 in HCC cell lines. (d) The overall survival rate of HCC patients with different expression level of DHRS4-AS1. N = 3, *p < 0.05, **p < 0.01

Figure 2. Overexpression of DHRS4-AS1 restricted HCC cell growth in vitro. (a) The expression level of DHRS4-AS1 determined by qRT-PCR. (b) Cell proliferation of HCC with DHRS4-AS1 overexpression that estimated by CCK-8. (c) The result of BrdU assay. (d) Colony-forming assay demonstrated decreased cell proliferation in DHRS4-AS1 up-regulated HCC cells. (e-f) Flow cytometry showed that overexpression of DHRS4-AS1 resulted in potentiated cell apoptosis, and cell cycle was captured at G0/G1 phase. (g) The expression level and quantitative analysis of apoptosis related proteins and cell cycle related protein detected via western blot. N = 3, *p < 0.05

Figure 3. Knockdown of DHRS4-AS1 accelerated HCC cell growth in vitro. (a) The expression level of DHRS4-AS1 determined by qRT-PCR. (b) Cell growth of HCC with DHRS4-AS1 down-regulation that determined through CCK-8. (c) The result of BrdU assay. (d) Colony-forming assay demonstrated enhanced cell proliferation in DHRS4-AS1 down-regulated HCC cells. (e-f) Flow cytometry showed that silencing of DHRS4-AS1 resulted in alleviated cell apoptosis, and cell cycle that captured at G0/G1 phase dropped. (g) The expression level and quantitative analysis of apoptosis and cell cycle related protein detected via western blot. N = 3, *p < 0.05

Figure 4. The tumor suppressed effect of DHRS4-AS1 in vivo. (a-b) Tumor size of HCC after 21-day of treatment. (c-d) The average tumor volume of HCC during 21-day of treatment. (e-f) The average tumor weight of HCC during 21-day of treatment. N = 4, ***p < 0.001

Table 3. Correlation of miR-522-3p level with clinicopathological characteristics in HCC patients

characteristic	case	miR-522-3p level		P value
		low	high
All case	60	30	30
Age (years)				0.519
<60	27	14	13
≥60	33	16	17
Gender				0.417
Female	21	9	12
Male	39	21	18
Liver cirrhosis				0.519
No	12	7	5
Yes	48	23	25
HBsAg status				0.284
Negative	22	13	9
Positive	38	17	21
AFP (ng/ml)				0.012*
≤ 20	19	14	5
> 20	41	16	25
Tumor size (cm)				0.004**
≤ 5	44	27	17
> 5	16	3	13
Tumor multiplicity				0.017*
Single	37	23	14
Multiple	23	7	16
Edmondson grade				0.194
I–II	33	14	19
III–IV	27	16	11
TNM stage				0.002**
I–II	43	27	16
III–IV	17	3	14

Figure 5. miR-522-3p was identified as a target gene of DHRS4-AS1. (a) The bioinformatics prediction biding site. (b) The result of dual-luciferase assay. (c) miR-522-3p was overexpressed in HCC tissues. (d) QRT-PCR detected significant high expression of miR-522-3p in HCC cell lines. N = 3, *p < 0.05, **p < 0.01

Figure 6. miR-522-3p reversed the inhibitory effects brought by DHRS4-AS1. (a) QRT-PCR determined the expression level of miR-522-3p. (b) CCK-8 assay showed that miR-522-3p promoted cell proliferation in DHRS4-AS1 and miR-522-3p mimics co-treated group versus solo DHRS4-AS1 ov treated group. (c) The result of BrdU assay. (d) Colony-forming experiment showed that miR-522-3p reversed the cell suppressed effect brought by DHRS4-AS1. (e-f) Cell apoptosis rate and cell cycle examined by flow cytometry. (g) The level and quantitative analysis of apoptosis related proteins’ and cell cycle related protein’s abundance detected via western blot. N = 3, *p < 0.05, **p < 0.01

Figure 7. SOCS5 was identified as a target gene of miR-522-3p. (a) The bioinformatics prediction performed biding site. (b) The result of dual-luciferase assay. (c) Western blot and quantitative analysis showed that SOCS5 was down-regulated in HCC tissues. (d) QRT-PCR detected significant low expression of SOCS5 in HCC cell lines. N = 3, *p < 0.05, **p < 0.01

Figure 8. SOCS5 reversed the effects brought by miR-522-3p. (a) QRT-PCR and (b) western blot determined the expression level of SOCS5. (c) CCK-8 assay showed that SOCS5 alleviated cell growth in miR-522-3p inhibitor and si-SOCS5 co-treated group versus solo miR-522-3p inhibitor treated group. (d) The result of BrdU assay. (e) Colony-forming experiment showed that SOCS5 reversed the cell promoted effect brought by miR-522-3p. (f) Cell apoptosis rate and (g) cell cycle examined by flow cytometry. (h) The level and quantitative analysis of apoptosis related proteins’ cell cycle related protein’s abundance detected via western blot. N = 3, *p < 0.05, **p < 0.01

Data Availability Statement

Research data could be available from the corresponding author.