Impact of exoD gene knockout on the polyhydroxybutyrate overaccumulating mutant Mt_a24

Figures & data

Table 1. List of primers used for the plasmid construction and genome integration screening of the transformants. Italic – sequence of overhang for Gibson Assembly®; pBS – pBlueskript II SK (+)

	Nr.	Description	Sequence 5`-> 3`	Binding site
Homologous integration sites	10–01 F	exoD US	gaagctggtttagcggatattc	Genome
	10–02 R	exoD US	actgatggggggtaaagc	Genome
	10–03 F	exoD DS	acccttaatctgagaggttttttg	Genome
	10–04 R	exoD DS	taatttggggaaaccgactaag	Genome
	10–05 F	exoDUS-G	tcgacggtatcgataagctgaagctggtttagcggatattc	Genome
	10–06 R	exoDUS-DS-G	caaaaaacctctcagattaagggtactgatggggggtaaagc	Genome
	10–07 R	DS_exoD_G	ggctgcaggaattcgatatctaatttggggaaaccgactaag	Genome
Selection marker	6–11 F	CmR	tgatcgggcacgtaagaggttccaac	pEERM4
	6–12 R	CmR	ttacgccccgccctgcca	pEERM4
	6–22 F	exoD-CmR	gctttaccccccatcagttgatcgggcacgtaaga	pEERM4
	6–23 R	exoD-CmR	caaaaaacctctcagattaagggtttacgccccgccc	pEERM4
Plasmid backbone	9–29 F	pBS	gatatcgaattcctgcagcc	pBS
	9–30 R	pBS	aagcttatcgataccgtcgac	pBS
Genome integration check	10–15 F	WT_exoD	tattccacccccttcggagt	Genome
	10–16 R	KOexoD_DS	cccaggaacaagcggagtta	Genome
	6–34 F	KOexoD_CmR	agttgatcgggcacgtaagag	pEERM4

Figure 1. Genetic modification of a PHB overaccumulating mutant Mt_a24. a) Schematic demonstration of genome section of the wild type with the gene exoD and the generated transformant with exchange of exoD through a chloramphenicol resistance gene and the binding sites of the primers for the verification of genomic integration. b) Multiplex-polymerase chain reaction with the OneTaq® Quick Load® DNA polymerase (NEB) and the primers 6–34 F, 10–15 F and 10–16 R to verify the knockout (KO) of exoD in the transformants generated via electroporation of the Mt_a24 mutant

Figure 2. Characterization of the unmodified mutant strain Mt_a24 and its two transformants KOexoD#4 and KOexoD#65 carrying a knockout of the gene exoD by replacement with a chloramphenicol resistance gene, during a cultivation of 7 days in standard BG11 medium followed by a 7 days cultivation within medium deficient of nitrogen and phosphorus with an intermediate sampling on day 4 of limitation. a) determination of the dry cell weight (DCW) by measurement of the optical density at 750 nm; b) analysis of the polyhydroxybutyrate (PHB) yield after acid hydrolyzation and HPLC measurement; c) analysis of the glycogen yield after acid hydrolyzation and IC measurement

Figure 3. Analysis of the three different EPS fractions, which are either excreted into the medium (S-EPS), loosely bound (LB-EPS) or tightly bound (TB-EPS) to the cell, of the unmodified control strain Mt_a24 and its two transformants KOexoD#4 and KOexoD#65 in standard and nitrogen and phosphorus limited medium (-NP). The analysis was done by hydrolyzation of EPS into monomers, reacted with phenol and measured via a spectrophotometer

Figure 4. Impact of exoD gene knockout in the two transformants KOexoD#4 (b, e, h, k, n) and KOexoD#65 (c, f, i, l, o) compared to the control strain Mt_a24 (a, d, g, j, m) under different cultivation conditions showed by scanning electron microscope (SEM) imaging. The samples were prepared by fixing the cells (OD₇₃₀ = 0.7) in glutaraldehyde overnight followed by three washing steps, Au-spattering and imaging at the TESCAN MIRA3 FEG-SEM microscope. Images a – c, standard cultivation conditions on day 7 (D₇); images d – f standard cultivation conditions on day 11 (D₁₁); images g – i nitrogen and phosphorus limited medium on day 11 (D₁₁-NP); images j – l standard cultivation conditions on day 14 (D₁₄); images m – o nitrogen and phosphorus limited medium on day 14 (D₁₄-NP). Black marks (D₁₁) on the cells resulted from the measurement. The pattern on the cell surface results from the Au spatter coating