G-protein-signaling modulator 2 expression and role in a CD133⁺ pancreatic cancer stem cell subset

Figures & data

Table 1 GPSM2 and GAPDH primers

Gene	Sequence (5′–3′)	Product size (bp)
GPSM2
F primer	GGCCATTGATTATCATCTGAAGC	99
R primer	TCCTTACCGTGTTTGAAAGGAA
GAPDH
F primer	CCACTAGGCGCTCACTGTTC	108
R primer	AGGCGCCCAATACGACCAA

Abbreviations: GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GPSM2, G-protein-signaling modulator 2.

Figure 1 CD133⁺PANC-1 cells have greater tumorigenic capacity than CD133⁻PANC-1 cells.

Notes: PANC-1 cells were sorted into CD133⁻ and CD133⁺ subsets. To evaluate the purity of each population, the percentages of CD133⁺ cells in the CD133⁺ (A) and CD133⁻ (B) subsets were assessed by flow cytometry. In-vivo tumorigenesis assay of CD133⁻ and CD133⁺ cell subsets in nude mice. Representative mice are shown at 2 weeks after injection (C). Subcutaneous tumor growth in nude mice. Results represent the averages of volumes from six mice as estimated using calipers (D). Representative tumors from CD133⁻ and CD133⁺ cells after 4 weeks (E). Average mass of tumors from the two groups of mice (F). (**P<0.01).

Abbreviation: FITC, fluorescein isothiocyanate.

Figure 2 GPSM2 expression is elevated in CD133⁺PANC-1 cells.

Notes: GPSM2 mRNA expression in unselected PANC-1 cells (Total), CD133⁻PANC-1 cells (CD133⁻), and CD133⁺PANC-1 cells (CD133⁺) (A). GPSM2 protein expression of PANC-1 cells in each group (B). Results are representative of three independent experiments. (*P<0.05, **P<0.01).

Abbreviations: GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GPSM2, G-protein-signaling modulator 2.

Table 2 Comparison of cell growth inhibition rates (%) between shGPSM2 and shNC cells

Group	24 hours (n=3)	48 hours (n=3)	72 hours (n=3)
shNC	0.30±1.18	1.77±8.14	1.93±1.78
shGPS M2	4.22±3.51	10.71±0.17*	11.93±5.59*

Note:

* P<0.05 vs shNC group.

Abbreviation: GPSM2, G-protein-signaling modulator 2.

Figure 3 Downregulation of GPSM2 inhibits proliferation of CD133⁺PANC-1 cells.

Notes: GPSM2 mRNA expression in untransfected (Blank), shNC, and shGPSM2 CD133-positive PANC-1 cells (A). GPSM2 protein expression in each group (B). Cell proliferation rates as assessed by MTT assay (C). Results are representative of three independent experiments. (*P<0.05, **P<0.01 vs Blank group; ^#P<0.05 vs shNC group).

Abbreviations: GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GPSM2, G-protein-signaling modulator 2.

Figure 4 Downregulation of GPSM2 inhibits the colony formation ability of CD133⁺PANC-1 cells.

Notes: Representative images of colony formation by untransfected (Blank), shNC, and shGPSM2 CD133⁺PANC-1 cells (A). The average number of colonies per group (*P<0.05) (B).

Abbreviation: GPSM2, G-protein-signaling modulator 2.

Figure 5 Downregulation of GPSM2 inhibits the migration ability of CD133⁺PANC-1 cells.

Notes: Representative images of migrating cells in Transwell assays for untransfected (Blank), shNC, shGPSM2, and CD133⁺PANC-1 cells (A). The average number of colonies per group. (*P<0.05) (B).

Abbreviation: GPSM2, G-protein-signaling modulator 2.