Differential changes in expression of inflammatory mRNA and protein after oleic acid-induced acute lung injury

Abstract

Background: Acute Respiratory Distress syndrome (ARDS) is a clinical syndrome of noncardiac pulmonary edema and inflammation leading to acute respiratory failure. We used the oleic acid infusion pig model of ARDS resembling human disease to explore cytokine changes in white blood cells (WBC) and plasma proteins, comparing baseline to ARDS values. Methods: Nineteen juvenile female swine were included in the study. ARDS defined by a PaO₂/FiO2 ratio < 300 was induced by continuous oleic acid infusion. Arterial blood was drawn before and during oleic acid infusion, and when ARDS was established. Cytokine expression in WBC was analyzed by RT-qPCR and plasma protein expression by ELISA. Results: The median concentration of IFN-γ mRNA was estimated to be 59% (p = 0.006) and of IL-6 to be 44.4% (p = 0.003) of the baseline amount. No significant changes were detected for TNF-α, IL-17, and IL-10 mRNA expression. In contrast, the concentrations of plasma IFN-γ and IL-6 were significantly higher (p = 0.004 and p = 0.048 resp.), and TNF-α was significantly lower (p = 0.006) at ARDS compared to baseline. Conclusions: The change of proinflammatory cytokines IFN-γ and IL-6 expression is different comparing mRNA and plasma proteins at oleic acid-induced ARDS compared to baseline. The migration of cells to the lung may be the cause for this discrepancy.

Keywords:

• Lung injury
• ARDS
• IL-6
• IFN-g
• lung
• oleic acid
• biomarker
• inflammation

1. Introduction

Acute Respiratory Distress Syndrome (ARDS) is a life-threatening condition characterized by rapid onset and acute hypoxemic respiratory failure associated with substantial morbidity and mortality.^1,2 The severity of ARDS is defined based on the degree of hypoxemia assessed by the Horowitz quotient (PaO₂:FiO₂ ratio) or oxygenation index.^3,4 Oleic acid infusion is often used to investigate the development of ARDS caused by pulmonary fat embolization that is attributed to long bone fracture, burns, acute pancreatitis, and heat exposure.^5,6 In addition, oleic acid is the most common and abundant fatty acid transported in blood bound to albumin or as lipoproteins to prevent cytotoxicity. Released by injury, free fatty acids including oleic acid change membrane structure and cause vascular leakage. Six hours after intravenous oleic acid injection in mice or rats, the serum TNF-α and IL-6 levels are significantly increased.^7,8 Thus, intravenous oleic acid infusion disrupting the integrity of the alveolar-capillary barrier is a great model for ARDS, causing severe alveolar degeneration, interstitial edema, inflammatory cell infiltration, and vascular congestion secondary to activated inflammatory pathways.^1,9–14 The swine model of oleic acid infusion is often used because their lung resemble human lungs physiologically and immunologically.^14–18

However, cytokine expression during ARDS varies with study design and models, and no study reports early changes of inflammatory markers in blood before, at the time of clinical insult, and when ARDS criteria is met. This study aims to identify cytokine mRNA expression at the initiation of oleic acid infusion and at the time of achieving ARDS defined by a PaO₂/FiO₂ ratio <300 in a swine model of oleic acid infusion and compare it to the protein concentration at both time points.

2. Materials and methods

2.1. Study design

This observational study was approved by the University of Wisconsin Institutional Animal Care and Use Committee (IACUC) in accordance with the guidelines in the US Department of Health and Human Services and the National Institutes for Health. Female pigs of 20 ± 3 kg, corresponding to a human age of 6–7 years of age, were sedated with 4–7 mg/kg of Telazol and 2 mg/kg of Xylazine.¹⁹ Intubation and mechanical ventilation with a tidal volume (Vt) of 8–10 ml/kg was initiated. Animals were kept under general anesthesia with 2% isoflurane, and ventilation was performed at a fraction of inspired oxygen (FiO₂) of 0.50 and Positive End Expiratory Pressure (PEEP) of 7–8 cmH₂O. The respiratory rate was initially set at 20 breaths per minute and then adjusted to maintain PaCO₂ between 35–45 mmHg until induction of ARDS. An intravenous catheter was placed in each ear for drug delivery. Two additional central catheters were placed each in the right femoral vein and right femoral artery for pressure measurement and oleic acid infusion. After stabilization, approximately 4 mL blood samples were obtained through a femoral artery catheter at baseline immediately before oleic acid infusion. Continuous oleic acid (Methyl Oleate, TCI America, Portland, OR) infusion was initiated at a rate of 0.05 mL/kg and titrated up to 0.6 mL/kg every 15 min until ARDS was achieved. This results in an approximate total of 5.25 mL oleic acid infused after 90 min.

Arterial blood samples were obtained immediately following intubation, prior to initiating oleic acid, then every 15 min, while infusing oleic acid, to monitor acid-base and gas exchange, including PaO₂. ARDS was defined per Berlin criteria including presence of acute hypoxemic respiratory failure defined by P/F ratio < 300 mmHg, bilateral opacities on chest x-ray, a minimum of 5 cm H₂O of positive end-expiratory pressure (PEEP) and chest x-ray imaging³). In addition, and given that his was a pediatric model, we insured that all animals met the PALICC definition of ARDS including oxygenation index (OI).²⁰ Once ARDS was achieved, a final blood sample was drawn through the femoral artery catheter and oleic acid infusion was stopped at that time. Arterial blood samples were analyzed using a pHOx Ultra blood gas analyzer (Nova Biomedical, Waltham, MA).

2.2. Sample preparation

Blood samples were taken prior to oleic-acid injection and after ARDS was apparent, as described earlier. Blood was collected in EDTA blood collection tubes (BD Vacutainer; Becton Dickinson, NJ), centrifuged, and plasma was frozen at −80 °C. Red blood cells were lysed with ammonium chloride solution (155 mM NH₄Cl, 10 mM KHCO₃, 0.1 mM EDTA, pH 7.3) and total RNA was extracted from white blood cells (WBC) using Spin column extraction (SV Total RNA Isolation (Promega, Madison, WI). Briefly, the cell pellet was lysed in RNA lysis buffer, loaded onto spin columns, and purified by a series of centrifugations. Total bound RNA was eluted with H₂O. Purity and concentration were determined using NanoDrop Spectrophotometer (Thermo Fisher Scientific; Waltham, MA) at wavelengths 230, 260, and 280 nm. cDNA was synthesized by reverse transcription (GoScript™ Reverse Transcription System by Promega, Madison, WI). cDNA purity and concentration were determined and samples were used for PCR or kept frozen at −80 °C.

2.3. qPCR

Primers were selected using Primer-BLAST from the National Library of Medicine. Swine (Sus Scrofa) gene sequences used for primer design were taken from the National Center for Biotechnology Information and CDS was used for primer design. Primer sequences are shown in (Table 1) and were purchased from Integrated DNA Technologies (Integrated DNA Technologies, Coralville, IA). qPCR was prepared following the protocol from Promega and run in duplicates (GoTaq qPCR, Promega, WI). qPCR data were analyzed by averaging the duplicates and using the ΔΔCt method with RING finger protein 7 (RNF7) as the reference gene to determine the fold change compared to baseline expression.

Table 1. Primer sequences.

mRNA	Forward primer sequence	Reverse primer sequence
RNF7	AAACAGAACAATCGCTGCCC	TTTGCCGATTCTTTGGACCAC
IFN-γ	GGCCATTCAAAGGAGCATGG	TCAGTTTCCCAGAGCTACCA
TNF-α	GCCCTTCCACCAACGTTTTC	CAAGGGCTCTTGATGGCAGA
IL-17	TGTGAGATCCTCGTCCCTGT	GCATCCTGGACTTTGTGGGA
IL-10	TGCATCCACTTCCCAACCAG	AACTCTTCACTGGGCCGAAG
IL-6	TGGGGCACCTGAGATTGATG	GGACAGGTTTCTGACCAGAGG

Primer sequences used for qPCR: RNF7: RING Finger Protein 7; IFN-γ: interferon-γ; TNF-α: tumor necrosis factor-α, IL: interleukin.

2.4. ELISA

Plasma cytokines were determined by a pig specific ELISA following the protocols provided (IL-1β was purchased from Abcam®, Cambridge, MA, and IFN-γ, IL-6, TNF-α, and IL-10 were purchased from Invitrogen, Thermo Fisher, Waltham, MA). IL-1β, IL-6, IL-10, and TNF-α ELISA were 5 step procedures with antigen binding, biotin conjugate binding, Streptavidin-HRP binding, chromagen incubation, and stop solution addition. The IFN-γ ELISA was a 4 step procedure with antigen and biotin binding combined in one step. All plates were read within 15 min at 450 nm and the cytokine concentration was determined based on the concentration of the standards.

2.5. Statistics

For each cytokine, the signed-rank test was used to assess whether the distribution of relative concentrations (i.e., fold changes relative to baseline) was shifted away from 1. Spearman’s rank correlation coefficient (r_s) was used to describe the association between each cytokine’s relative concentration and either time to ARDS or the P/F ratio at baseline. All analyses were performed using R (v 4.2.0).

3. Results

Inflammatory cytokine mRNA expression in WBCs was determined in 17 female pigs except for IL-17 mRNA, which was analyzed in 16 animals. Plasma IL-1β protein concentration was determined in 19 female pigs with 14 being included in the cytokine mRNA analysis. All animals showed a significant drop in pH, PaO₂, and a significant increase in PaCO₂ comparing baseline with ARDS values (Table 2). Median (IQR) time to achieve ARDS was 107 (92–139) minutes with a median volume of 7.4 (5.3–9.1) mL oleic acid infused. Laboratory and physiologic data prior and following ARDS induction are summarized in Figure 1 and Table 2. On average, the P/F ratio, once ARDS was achieved, dropped from 594 (95% CI; 575–615) to 270 (95% CI; 256–291). The oxygenation index once ARDS was achieved increased significantly from 1.71 at baseline to 4.48 mL/cmH₂O by 2.77 (95% CI: 2.51–3.02; p < 0.001), indicating mild ARDS per PALICC definition. Similarly, the average Vd/Vt ratio, once ARDS was achieved was 0.43 mL/cmH₂O compared to 0.28 mL/cmH₂O at baseline, a significant increase by 0.15 (95% CI: 0.12–0.19; p < 0.001) mL/cmH₂O) translating to the ARDS response being 169% (95% CI: 146–192%) greater than the baseline response. Further supporting the development of ARDS is the decline of compliance with the average response, once ARDS achieved, being 4.21 (95% CI: 3.07–5.34; p < 0.001) mL/cmH₂O lower than the response at baseline (7.16 vs 11.4 mL/cmH₂O), which roughly translates to the compliance at ARDS being 35% (95% CI: 28–42%) less than the baseline response.

Figure 1. Average response of oxygenation index, Vd/Vt ratio, and compliance comparing baseline with ARDS.

Table 2. Laboratory and physiology data.

Variable (n)	Baseline (IQR)	ARDS (IQR)
mL OA infused (21)		7.0 (5.3–11.3)
Infusion time (min) (21)		107.0 (92–139)
PaO2 (mmHg) (21)	297.7 (269.5–308.0)	135.4 (128.0–145.5)
PaCO2 (mmHg) (17)	37.6 (36.1–40.5)	51.8 (48.0–57.6)
P/F ratio (21)	594 (575–615)	270.8 (256.1–291.0)
A-a gradient (21)	6.0 (0.1–30.6)	146.8 (137.6–166.0)
Blood pH (20)	7.43 (7.40–7.46)	7.31 (7.26–7.36)

Median values comparing the time before oleic acid infusion (baseline) with the time once ARDS was achieved (P/F ratio < 300). All variables are shown as median (IQR)

We tested WBC mRNA expression of the cytokines IFN-γ, TNF-α, IL-6, IL-10, and IL-17. Two of these cytokines, IFN-γ (p = 0.006) and IL-6 (p = 0.003), showed a significantly reduced mRNA expression at ARDS compared to baseline. The median concentration of IFN-γ mRNA was estimated to be 59% (95% CI: 40.9–85.6%) of the baseline amount, while the median mRNA expression of IL-6 was 44.4% (95% CI: 25.6–77.1%) of its baseline level (Figure 2). Other cytokines (TNF-α, IL-17, IL-10) had relative concentrations that did not systematically deviate from 1 (p > 0.15 for each). Relative cytokine concentrations were not associated with time to ARDS (p ≥ 0.07) (Figure 3). Neither was there any association between the P/F ratio at baseline and relative cytokine concentration (p ≥ 0.10).

Figure 2. Fold changes (ARDS relative to baseline) for cytokines measured using RT-qPCR. During ARDS, INF-γ and IL-6 decreased to 59% and 44% of its baseline value, respectively. TNF-α, IL-17, and IL-10 had non-significant fold changes.

Figure 3. No significance between time to ARDS and cytokine levels. Relative concentrations of mRNA of cytokines had no significant correlation with time it induces ARDS.

Plasma cytokine concentration was measured by ELISA in n = 19 pigs. (Of these 19, 14 were among the 17 used in the earlier analysis and five were specific to just this one cytokine. Likewise, 3 of the original 17 animals were particular to that earlier data set and had no protein data.) The full collection of 19 animals was used for analysis of relative IL-1β concentrations while the two correlational analyses used data from 18 of the animals (time to ARDS and P/F ratio at baseline missing for one pig).

The relative plasma concentration of IL-1β and IL-10 at ARDS did not significantly differ (p = 0.332 and 0.113 respectively) from baseline (Figure 4). Neither was there any noted association between relative concentrations of IL-1β and the P/F ratio at baseline (r_s = 0.18, p = 0.47). There was some evidence (p = 0.026) of a direct association between time to ARDS and the relative concentration of IL-1β (r_s = 0.52) such that increases in one variable are associated with an increase in the other (Figure 5).

Figure 4. Fold changes (ARDS relative to baseline) for plasma cytokines measured by ELISA. The significance of change is represented by p values <0.05.

Figure 5. Correlation between IL-1β and time needed to reach ARDS. Significant correlation was found between IL-1β levels at ARDS and the time it took the animal to reach ARDS.

4. Discussion

ARDS is a heterogeneous disease and animal models are instrumental in untangling pathophysiology and disease progression. Although every model has limitations compared to human disease, knowing the onset time and type of insult enables tracking pathological changes over time.^21,22 Oleic acid infusion is an established model of lung injury and ARDS, and often used to study inflammatory changes and potential treatments.^23–25 However, early changes of inflammatory markers before reaching ARDS are not frequently captured in clinical studies.⁹ In the present study, we analyzed changes in inflammatory mRNA expression in blood leukocytes before and immediately after intravenous oleic acid infusion. In addition, we analyzed the plasma protein concentration of the same inflammation markers. Our data show decreased IFN-γ and IL-6 mRNA expression in WBC compared to baseline values. In contrast, the plasma IL-6 and IFN-γ concentrations were increased when reaching ARDS compared to baseline. This finding holds paramount importance as recognizing early changes in inflammatory markers may contribute to a better understanding of disease subtypes and mechanisms leading to ARDS. Furthermore, our findings hold promise in aiding clinicians better to comprehend the role of inflammatory markers during ARDS progression, enabling them to navigate the limitations and opportunities associated with using these markers in the management and monitoring of ARDS

Oleic acid, a common fatty acid in the human body, is transported bound to albumin or as lipoproteins, preventing cytotoxicity. Free fatty acids can change membrane structure and cause vascular leakage and therefore oleic acid infusion was used as a model to reproduce ARDS to investigate ventilation strategies, pathophysiology, or interventions.^{12,14,17,18,23,24,26–30} This model was established for acute lung injury in sheep, dogs, and rats and used in many other species.^31–36 The injection procedure varies substantially between protocols. Single injections, multiple injections, and continuous infusion over a given time are the most common methods.^37–39 Single bolus injection caused the animals to be unstable and unsuitable for the experiment, which was also reported by Borges et al., who described high mortality and limited reproducibility using a single dose.⁴⁰ Therefore, we chose a continuous infusion initiated at a rate of 0.05 mL/kg/minute and titrated up to 0.6 mL/kg/minute every 15 min resulting in 5.25 ml oleic acid after 90 min. This protocol was adopted from Sum-Ping et al.⁴¹ In our experiment the mortality was very low with 3 animals dying within the first 50 animals.

Effective treatment of ARDS is challenging due to ARDS heterogeneity and timing of treatment. Using subtype, phenotype, and biomarkers therefore could be very beneficial to classify ARDS and optimize therapy.^42–44 Accordingly, two ARDS sub-phenotypes, hyperinflammation and hypoinflammation, determined by plasma biomarkers, react differently to treatment.^45–47 Hyperinflamma­tion is characterized by elevated IL-6 and IL-8 plasma levels, which in contrast are reduced in hypoinflammation.^46,48,49 A recent study of adult ARDS patients showed that bronchoalveolar lavage fluid (BALF)-derived classification was associated with clinical severity of pulmonary disease differed from plasma-derived inflammation-based grouping.⁵⁰ Patients selected for this study were on invasive mechanical ventilation within 48 h of ARDS onset, hence severe disease. IL-6 and IL-8 protein concentration in plasma were not different after a Bonferroni correction for multiple hypothesis tests but highly significantly different in BALF.⁵⁰ Moreover, serum high mobility group box 1 (HMGB1) protein levels in pediatric living donor liver transplantation (LDLT) recipients at 30 min after reperfusion were positively associated with early PARDS.⁵¹ Sepsis patients who would develop ARDS later had increased expression of Bactericidal Permeability-Increasing Protein (BPI), Olfactomedin 4 (OLFM4), Lipocalin2 (LCN2), CD24, matrix metalloprotease-8 (MMP8) and decreased expression of MME at an early time compared to patients who did not develop ARDS.⁵² All these gene products are related to pathways of the innate immune system. This indicates that timing of sample acquisition, sample source, and mechanism of injury are important variables to identify subtypes and phenotypes in ARDS.

The analysis of our samples included the comparison of pre- to post-injury inflammatory markers in white blood cells and plasma. The median time of 107 (92–139) minutes to develop ARDS may explain why our data are differ from most published studies. The noted reduction in IFN-γ and IL-6 mRNA expression and increase in plasma IFN-γ and IL-6 may therefore be a transient event. The correlation between the duration of the oleic acid infusion and volume with IL-1 protein plasma concentration supports this notion. Most published data were obtained at some time past ARDS onset. In addition, the control in our study was taken from the same pig prior to oleic acid injection, rather than a separate control animal or group. We compared cytokine protein or mRNA levels at ARDS with baseline levels in the same animal before OA infusion, while in most human studies, scientists measure cytokines or biomarkers at ARDS or at admission into the ICU/PICU comparing them to post-treatment data or control patients without ARDS. However, the difference between mRNA and protein data demonstrate that the interpretation of biomarker analysis depends on the specimen and kind of component, mRNA or protein. Fine-tuning of transcription, translation, and post-translational regulation enables the correct function of complex systems.^53,54 It also shows the importance of sample acquisition time.

Finally, to incorporate the clinical significance of our findings, it is imperative to underline the pivotal role of early identification of inflammatory markers in the progression of ARDS. The dynamics of cytokine expression, particularly IFN-γ, and IL-6, as elucidated in our study, could potentially provide a critical window for early recognition of ARDS, as the early detection of these markers could potentially herald the onset of ARDS, allowing for preemptive therapeutic strategies to ameliorate or even prevent the progression of this life-threatening condition. As highlighted above, human studies on ARDS face inherent limitations due to the rarity of capturing patients at the onset of the syndrome, thus restricting the ability to understand the early pathophysiological events fully. In this context, our study gains significant relevance by offering insights into the early inflammatory response within a controlled translational experimental setup, thereby helping with addressing the challenges faced in clinical settings. As our understanding of the molecular underpinnings of ARDS deepens, so too does the potential for developing targeted therapies that can mitigate the severity or even prevent the onset of ARDS in at-risk populations. In conclusion, the early identification of inflammatory markers could represent a critical juncture in the quest for improving ARDS outcomes. Our study provides a rationale for the investigation and potential inclusion of these biomarkers in the diagnostic and therapeutic approaches to ARDS, underscoring the need for further research in this domain.

Our study has many limitations: first, we were not able to obtain bronchoalveolar lavage fluid due to hemodynamic instability associated with our model and the defined endpoints of the experiments. Second, we did not obtain protein data on IFN-γ or IL-6. Further studies are required to better characterize the short-term changes in cytokine expression and the consequences for the progression of lung injury. Third, unanswered in this study is the question about the reason for the reduced mRNA expression in blood at the analyzed time point. Is it a downregulation of this mRNA expression or are cells expressing this mRNA migrating to the injured tissue, spleen, or lymph nodes? And forth, we did not analyze lymphocyte subpopulations and expression of cytokine mRNA and protein.

In conclusion, our study showed that the oleic-acid swine model of pediatric ARDS is a good model to study early inflammatory changes during lung injury simultaneously with heart and lung physiology. IFN-γ and IL-6 mRNA expression was significantly reduced in WBCs in less than 2 h at the time when ARDS was attained whereas IFN-γ and IL-6 protein concentration increased. These changes do not indicate the presence of ARDS, which needs to be determined by clinical criteria. However, they show that interpretation of data from a single class of biological component may not be enough for clinical interpretation. Further studies are required to define this reduction, which may be caused by cell migration as it has been observed in COVID-19 patients, change in mRNA expression, or both.⁵⁵ Future studies to identify subphenotypes of ARDS should also include the analysis of non-coding RNA including micro-RNA (miRNAs), circular RNA (circRNA), and long non-coding RNA (lncRNA). All these RNAs are involved in the regulation of inflammation and are differentially expressed between subjects who did and did not develop ARDS.^56–58

5. Impact

• The onset of acute respiratory distress (ARDS) is reflected by reduced IFN-γ and IL-6 mRNA expression in WBC and simultaneous increased IFN-γ and IL-6 plasma concentration. For clinical use as biomarkers the time of sample acquisition and analysis method is of great importance.

• Identifying early inflammatory changes may be important to characterize ARDS and initiate treatments to ameliorate disease progression.

Acknowledgments

We thank Jennifer Frank for her diligent work in collecting data during experiments. We thank Everett J Temme for helping handling the animals and performing CPR.

Declaration of interest

No potential conflict of interest was reported by the author(s).

Additional information

Funding

Fundet by a startup grant from the department of Pediatrics UW Madison