![Sample our Bioscience journals, sign in here to start your access, Latest two full volumes FREE to you for 14 days]({"type":"image" , "src" : "/sda/5925/TOC-Subject-Sample-2021-Bioscience.jpg"})
Abstract
tRNA genes are the integration sites of viral/plasmid genomes into their hosts chromosomes by homologous recombination catalyzed by integrases. The crossover between viral/plasmid and host genomes leaves 3′-fractional tRNA motif as tell-tale marker of integration on host-chromosome. This 3′-fractional tRNA motif on host genome is our retrenched tRNA (rtRNA). To track integration in Crenarchaea, host rtRNAs, and conserved features in viral/plasmid tRNA motifs and in integrases were identified. The viral-integrase has a conserved 24-nucleotide long motif, GTATTATGTTTACTCAATAGAGAA in the N-terminal region. Upstream of the viral tRNA motif has a conserved poly-cytosine region and a hairpin secondary structure. Corresponding to a host tRNA, we observe up to two rtRNAs on crenarchaeal chromosome. The length of the rtRNA is not random. The fraction of tRNA excised off in rtRNA is either 61.8, or 50, or 38.2, or 23.6%. Thus, the integration fragments the tRNA nonrandomly dividing it approximately in ratios 3:2, or 1:1, or 2:3, or 1:3. More than 79% of rtRNAs have lengths that are excised 38.2% off tRNA. It turns out that 38.2% excision implies that the ratio of the length of tRNA to its rtRNA is just 1.618, the golden ratio. Hence, the vast majority of rtRNAs are at or near the golden ratio. Evidence emerges of new extremophile viral entities.
Acknowledgments
Sanga Mitra thanks the Department of Science and Technology for financial support. Smarajit Das and Jayprokas Chakrabarti acknowledge the warm hospitality of EMBL, Heidelberg, during their visits. We thank Rini Chakraborty and Chiranjit Saha of Institute of Technology and Marine Engineering for help with analyses of data. Financial support came from intramural research funds of our home institutions. Finally, we owe a debt of gratitude to one of the anonymous referees for an invaluable observation on the nonrandomness of viral/plasmid integration in Crenarchaea. We have incorporated this observation in our manuscript.