ABA-dependent K⁺ flux is one of the important features of the drought response that distinguishes Catalpa from two different habitats

ABSTRACT

Abscisic acid (ABA)-induced stomatal closure can improve drought tolerance in higher plants. However, the relationship between ABA-related ion flux and improved drought resistance in the roots of woody plants is unclear. To investigate this relationship, we employed a noninvasive micro-test technique (NMT) to detect potassium (K⁺) flux in Catalpa fargesii and C. fargesii f. duclouxii after treatment with polyethylene glycol (PEG) and ABA. PEG treatment slightly increased the free proline content in both Catalpa species. However, simultaneous treatment with ABA and PEG resulted in a large increase in free proline content. Treatment with PEG led to a significant increase in K⁺ efflux, and both ABA and tetraethylammonium (TEA, a K⁺ channel inhibitor) blocked this efflux under short-term (1 d) and long-term (7 d) drought conditions. Furthermore, we detected SKOR (stelar K⁺ outward-rectifying channel) gene expression in roots, and the results showed that PEG significantly increased SKOR expression in C. fargesii f. duclouxii, but SKOR expression was inhibited by ABA in Catalpa fargesii. These findings indicate that ABA improves drought tolerance by inhibiting K⁺ efflux in Catalpa, but distinct ABA response patterns exist. Drought-tolerant species have better potassium retention are dependent on ABA, and can accumulate more proline than other species. SKOR is also ABA-dependent and sensitive to ABA, and K⁺ flux is a target of the ABA-mediated drought response.

KEYWORDS:

• Abscisic acid
• Catalpa
• drought tolerance
• k⁺ efflux
• noninvasive micro-test technique
• PEG
• TEA
• SKOR

Introduction

Drought is defined as severe water deficit or osmotic stress that leads to a large decline in the yield of higher plants. Since trees have a long-life cycle, they may be exposed to multiple short- and long-term droughts throughout their lifetime.¹ During drought, rapid accumulation of abscisic acid (ABA) regulates turgor pressure through osmotic adjustment,² and ABA-dependent and -independent signal transduction pathways are activated and deliver the signals above ground.^3-6

Catalpa is a beautiful native tree species in China. It has many advantages, including fast growth, high quality wood, and strong adaptability. However, different varieties of Catalpa (for example Catalpa fargesii and C. fargesii f. duclouxii) show different levels of drought-resistance in different environments.^7,8 Drought affects the osmotic potential of plant cells by reducing their water content. Therefore, for plants to survive drought, their osmotic potential must be adjusted by regulating cellular levels of organic solutes (e.g., amino acids) and inorganic ions such as potassium (K⁺).⁹ ABA, which is synthesized in roots and transported above ground, acts as a stress signal and can improve drought resistance during low-water conditions.^10-13 Because of the importance of K⁺ to proper cell functioning and the role of ABA in drought resistance, the signaling pathways involved in the regulation of cellular K⁺ content by ABA are of interest to many researchers.^14-16 Previous studies found that K⁺ channel activity facilitated the adaptation of maize roots to dry soils, but the role of ABA in regulating K⁺ flux was not clarified.^17,18 ABA inhibits K⁺ uptake during the germination of barley seeds, indicating that ABA regulates K⁺ channels in the roots of this species.¹⁹ Moreover, K⁺ channels may target ABA-perception sites in Arabidopsis thaliana suspension cells.²⁰ However, the mechanisms by which drought resistance is improved by ABA-mediated changes in K⁺ channels are unclear in many plants, especially trees.¹⁸

The aim of the present study was to identify the physiological mechanisms of ABA-improved drought tolerance in woody plants. We employed a noninvasive micro-test technique (NMT) to detect the K⁺ flux in Catalpa fargesii and C. fargesii f. duclouxii after treatment with PEG and ABA. ABA was found to enhance drought tolerance by inhibiting the K⁺ efflux that was activated by SKOR gene expression. Catalpa fargesii was more drought-resistant than C. fargesii f. duclouxii and showed both ABA-dependent and ABA-independent patterns of K⁺ flux.

Materials and methods

Plant materials and growth conditions

Catalpa fargesii and Catalpa fargesii duclouxii were collected in northwestern China (Gansu, Shaanxi Province) and in southwestern China (Guizhou, Yunnan, Province), respectively. Seeds (n = 400) of each species were sown in culture dishes and placed in an illumination box (10/14-h day/night cycle at 28/22°C with irradiance of 180 μmol m⁻²s⁻¹. The seeds were watered daily to ensure that the bottom of the culture dish remained wet. Seeds germinated after 4 d and were transplanted into plastic pots (12-cm diameter) with soil and cultured in the greenhouse at the Chinese Academy of Forestry. Seedlings (n = 36) of each species were washed with water to remove soil and cultured in four plastic pots (n = 9 per pot) each containing 6 L of growth solution (GS) including CaCl₂ 34 mg/L, KCl 1.68 mg/L, MgSO₄ 10.5 mg/L, NaCl 32.2 mg/L, and CuSO₄ 5 μg/L. The GS in the pots was continuously aerated and was replenished every 2 d. Greenhouse conditions included a temperature of 28–32°C, a 13-h photoperiod (5:30 AM-6:30 PM), and approximately 200 μmol m⁻²s⁻¹ photosynthetically active radiation.

PEG treatments

After 7 d of hydroponic growth, seedlings of each species were transferred to four plastic pots for treatment with different concentrations of PEG-6000. Four PEG-6000 concentrations (0, 100, 150, and 225 g/L) were administered (n = 3 plants for each concentration).

PEG and ABA treatment

Twenty-four plants of each species were transplanted into four plastic pots (n = 6 plants per pot). Each pot was treated with one of the following conditions (treatment names in parentheses): GS (CK, control); GS + 225 g/L PEG-6000 (PEG); GS + 100 μg/L ABA (ABA); or GS + 225 g/L PEG-6000 and 100 μg/L ABA (PEG + ABA). The osmotic pressure, Pn, and K⁺ flux of plant roots was determined after 1 (short-term) and 7 d (long-term).

Measurement of vapor pressure

The vapor pressure of the culture solution was measured using a vapor pressure osmometer (Vapro 5600, Wescor Inc., USA) at 25°C.

Measurement of proline

The free proline content of plants under long-term treatment (7 d) was determined using the approach described by Bates et al.²¹ with modifications. We added 5.0 ml 3% (w/v) sulfosalicylic acid to 20-mL glass tubes containing 0.5 g fresh leaves or roots, plugged the tubes, and boiled the mixtures in a water bath at 100°C for 10 min. After cooling, the mixtures were filtered into plastic tubes. Extracts (2 mL) of the filtrate were mixed with 2 mL glacial acetic acid and 2 mL ninhydrin in 20-ml plugged glass tubes and boiled at 100°C for 30 min. After cooling the mixtures to room temperature, 4 mL toluene was added to each tube. The tubes were shaken for 3 min and left to stand for 2 min, after which chromophores were separated and centrifuged at 3000 rpm for 5 min at 25°C. The absorbance of the chromophores was determined using a spectrophotometer (UV-2000, Unico Instrument Co., Shanghai, China) at a wavelength of 520 nm. Toluene was used as a blank. Proline concentrations (mg/g, fresh weight [FW] basis) were calculated using L-proline for the standard curve.

Measurement of K⁺ flux in roots

Net K⁺ fluxes were measured noninvasively by the NMT (BIO-001A; Younger USA, Amherst, MA) according to previously described methods.^22–28 The K⁺ concentration gradients were measured by moving the K⁺-specific microelectrode between two positions close to the root in a preset excursion (30 μm) at a programmable frequency of 0.2 Hz. Fluxes were automatically recorded at the root surface in 0.1 mM KCl, 0.1 mM CaCl₂, 0.3 mM MES, pH 6.0 after 5–10 min of reaching the steady-state fluxes.

Measurement of potassium content in roots

One and seven days after treatment seedlings in GS were harvested. Roots from each treatment were collected and dried. Part of the roots were cut into 1 cm fragments. The potassium content (mg/g, dry weight [DW] basis) in roots was measured by atomic absorption spectrometry and calculated using the standard curve of potassium.

Real-time PCR

Total RNA was isolated using TRIzol reagent (Invitrogen, US) according to the manufacturer’s instructions. Real-time PCR (qPCR) was performed using 2× UltraSYBR Mixture (CoWin Biosciences Company, Beijing, China) in triplicate with LineGene9600 Plus (Bioer, Hangzhou, China). Primer sequences (from Sunbiotech Co., Ltd., Beijing, China) for the targeted SKOR genes were forward, GCCAATTCACCTTCCTCGTAGA, reverse, CGATGGAGGCAGAGTTGTAGC. Primer for the reference gene is actin, were forward, CTCTGAGAATCACCGCCAACTACT, reverse, AGGCATATACTCTGGAGGCTTCAC. The relative expression was calculated with the 2^−ΔΔCT method (ΔCT = CT^SKOR – CT^actin).

Statistical analysis

In all experiments, data were obtained from at least three independent samples and the error bars in the figures represent the standard errors (SE). All statistical analyses were performed by one-tailed Student’s t-test. Among multi-group comparisons, the ANOVA was used. The results are presented as the mean ± SE (p < .05 is significant, p < .01 is extremely significant).

Results

PEG + ABA treatment increased the free proline content

The free proline content of roots after 7 d of treatment with PEG, ABA, and PEG + ABA was measured to determine the degree of drought tolerance levels (Figure 1). PEG and PEG + ABA treatment led to an increased free proline content in roots in both species. ABA treatment did not affect the free proline content significantly in either C. fargesii or C. fargesii f. duclouxii roots. Notably, when treated with PEG + ABA, the free proline content increased to approximately 2.5-fold of the value in the PEG treatment group in the roots of C. fargesii. However, in the roots of C. fargesii f. duclouxii, the free proline contents were similar in the PEG and PEG+ABA groups. The results showed that the free proline of C. fargesii roots was dependent on ABA induction, but that in C. fargesii f. duclouxii roots was independent of ABA under drought conditions.

Figure 1. Free proline contents in Catalpa fargesii and C. fargesii f. duclouxii treated with PEG and ABA. Free proline content of roots after 7 d of treatment with PEG, ABA, and PEG + ABA. n = 3–5, P < .01.

PEG increased K⁺ efflux and ABA reduced K⁺ loss

To select an optimal location to determine the K⁺ flux in roots, we measured the K⁺ flux at 0, 500, 700, 1200, 1800, 5000, and 10 000 μm from the root tip in both species. The largest K⁺ flux occurred at 500–700 μm in both species (Figure S3); thus, we measured the K⁺ flux 600 μm from the root tip in our studies.

In C. fargesii roots, the efflux of K⁺ was significantly (p < .001) elevated after short-term(1 d) PEG treatment (1022 pmol cm⁻²s⁻¹) compared to that after the CK, ABA, and PEG + ABA treatments (170, 87, and 53 pmol cm⁻²s⁻¹, respectively) (Figure 2(a,b)). After long-term (7 d) treatment, K⁺ efflux (737 pmol cm⁻²s⁻¹) was still higher in the PEG treatment group than in the CK group. However, ABA and PEG + ABA treatments showed a lower K⁺ efflux from roots relative to CK, with rates of 161 and 58 pmol cm⁻²s⁻¹, respectively (Figure 3(a,b)).

Figure 2. K⁺ efflux in roots of C. fargesii and C. fargesii f. duclouxii after 1 d of treatment with PEG, ABA, or PEG + ABA. Average K⁺ efflux for the measurement period (400 s) (c). Positive values indicate K⁺ efflux. n = 3–6, P < .01.

Figure 3. K⁺ efflux in roots of C. fargesii (a, b) and C. fargesii f. duclouxii (c, d) after 7 d of treatment with PEG, ABA, or PEG + ABA. Positive values indicate K⁺ efflux. n = 3–6, P < .01.

One day of PEG treatment led to a significant increase in K⁺ efflux in C. fargesii f. duclouxii compared with the control (p < .001; 1 d, Figure 2(c,d)). K⁺ efflux in the PEG + ABA treatment group (1402 pmol cm⁻²s⁻¹) was not significantly different from that of the PEG treatment group, but ABA caused a significant decrease in K⁺ efflux (96 pmol cm⁻²s⁻¹; p < .001) relative to PEG. K⁺ efflux decreased significantly (p < .001) after 7 d compared to treatment for 1 d (Figure 3(c,d)). After 7 d, K⁺ efflux in CK (55 pmol cm⁻²s⁻¹) was not significantly different from that in the ABA or ABA + PEG treatments (106 and 109 pmol cm⁻²s⁻¹, respectively). Plants treated with PEG had the highest K⁺-efflux values (297 pmol cm⁻²s⁻¹).

We used tetraethylammonium (TEA), a K⁺ channel blocker, to determine whether K⁺ efflux was regulated through K⁺ channels. Seedlings were treated for 1 d with CK, PEG, ABA, or PEG + ABA, followed by 1 h the TEA treatment. In C. fargesii seedlings, K⁺ efflux in the CK and CK + TEA treatments was 260 and 212 pmol cm⁻²s⁻¹, respectively (Figure 4). In C. fargesii f. duclouxii seedlings, K⁺ efflux was 406 and 11 pmol cm⁻²s⁻¹ in CK and CK + TEA, respectively. K⁺ efflux was significantly (p < .001) decreased in seedlings cultured in PEG, ABA, and ABA + PEG and treated with TEA compared to CK without TEA. Catalpa fargesii exhibited higher K⁺ efflux than C. fargesii f. duclouxii after short-term treatment (CK, PEG, ABA, or PEG+ABA) followed by TEA treatment (p < .001).

Figure 4. K⁺ efflux in roots of Catalpa fargesii (a, b) and C. fargesii f. duclouxii (c, d) seedlings treated with TEA for 30 min following 1 d of treatment with PEG, ABA, or PEG + ABA. Positive values indicate K⁺ efflux. n = 3–6, P < .01.

K⁺ content, PEG increased K⁺ efflux and ABA reduced K⁺ loss

The K⁺ content was increased in the PEG 1d treatment group in C. fargesii roots, but was decreased in C. fargesii f. duclouxii roots. The K⁺ content became balanced after 7 d (Figure 5). A faster response occurred in C. fargesii than in fargesii f. duclouxii. ABA can aid K⁺ retention in C. fargesii more than in C. fargesii f. duclouxii roots.

Figure 5. K⁺ content in roots of Catalpa fargesii (a) and C. fargesii f. duclouxii (b) seedlings treated for 1 d and 7 d with PEG, ABA, or PEG + ABA. n = 3–6, P < .01.

SKOR genes were activated by PEG

SKOR is a type of K⁺ channel for K⁺ outward movement of K⁺ from cell. After 1 d of PEG treatment, the expression of SKOR was sharply increased in C. fargesii f. duclouxii roots, but did not change significantly in C. fargesii roots (Figure 6(a,c)). With the extension of the treatment period, SKOR expression decreased in both C. fargesii and C. fargesii f. duclouxii roots (Figure 6(b,d)). The results showed that SKOR has a better sensitivity to drought stress in C. fargesii f. duclouxii than in C. fargesii.

Figure 6. SKOR gene expression levels in roots of Catalpa fargesii and C. fargesii f. duclouxii seedlings treated for 1 d (a) and 7 d (b) with PEG, ABA, or PEG + ABA. n = 3–6, P < .01.

SKOR is an outward- rectifying K⁺ channel located on the cell membrane. After PEG treatment, the SKOR expression in roots of C. fargesii and C. fargesii f. duclouxii roots showed different trends with the prolongation of drought stress time. At 1 day of treatment, the SKOR gene was significantly upregulated in C. fargesii f. duclouxii root, but a change was not obvious in C. fargesii. After 7 d of treatment, the SKOR gene was downregulated in C. fargesii root, while that in C. fargesii f. duclouxii roots was still upregulated. This indicates that SKOR gene expression in C. fargesii roots and C. fargesii f. duclouxii roots is sensitive to PEG stress, but the downregulated expression of SKOR in C. fargesii roots is beneficial to K⁺ retention in cells.

Discussion

Drought-induced osmotic stress critically affects the growth of forest trees.¹ Roots are the first plant organs to sense soil drought signals, and thus, the root cell membrane is the first line of defense against drought stress.²⁹ It has generally been thought that cell membrane integrity is a major determinant of the effects of drought on plants.³⁰ However, ion channels may also play an important role in mediating drought stress. Here, we used ABA to investigate the roles of K⁺ channels under drought stress in plant roots. ABA and K⁺ affect water balance under drought and salt stress conditions primarily through guard cell regulation, and increase cellular resistance to dehydration by inducing the expression of dehydration-tolerance proteins.^3,31-33

In the present study, drought stress enhanced root K⁺ efflux in both Catalpa species (Figures 2 and 3). After 1 d of PEG treatment, K⁺ efflux in roots of C. fargesii and C. fargesii f. duclouxii seedlings was more than 19-fold and 3-fold higher than that in the respective controls. After 7 d of treatment, root K⁺ efflux was 1.4-fold (C. fargesii) and 5.4-fold (C. fargesii f. duclouxii) higher than that in the respective controls. These results are consistent with other studies that showed that abiotic stresses, including drought, salinity, and reactive oxygen species induced K⁺ efflux in plant roots.^34-38 K⁺ efflux was partially inhibited by ABA (Figure 3) compared with PEG-6000 treatment in both species. The role of ABA as a K⁺ channel inhibitor was reported in previous studies that showed that ABA decreased the outward K⁺ current in maize roots and cells.^17,38 After short-term treatment with PEG, ABA, or PEG + ABA, we treated Catalpa seedlings with TEA for 60 min and found that ABA significantly reduced (but did not eliminate) K⁺ efflux (Figure 4). This observation led us to conclude that most of the K⁺ supply moves out of plant cells subjected to drought stress (PEG-6000 treatment). C. fargesii exhibited greater K⁺ efflux than C. fargesii f. duclouxii after 1 d of PEG-6000 treatment, but the trend was reversed after 7 d of treatment. Plant drought resistance is complex and involves various factors, including protective enzymes, solutes, and signal transduction. Thus, K⁺ accumulation in plant roots may be an important adaptive mechanism for survival under drought stress.³⁹

Gene regulation is an elemental factor in drought stress defense mechanisms. To reveal the mechanism and underlying reason why ABA improves drought tolerance by inhibiting K⁺ channels and efflux, we detected K⁺ outward channel gene SKOR. SKOR was identified in 1998,⁴⁰ and regulates K⁺ efflux by the ABA-dependent pathway to improve drought tolerance.^41-43 The SKOR and KAT driving forces for K⁺ are inwardly directed, and could be of use to improve plant growth on K⁺‐starved soil.⁴⁴ In these results, the expression of SKOR decreased in C. fargesii and increased in C. fargesii f. duclouxii with 1 day of drought stress, but it increased in roots of both Catalpa species at 7 d of drought stress. ABA can reduce SKOR expression in both C. fargesii and C. fargesii f. duclouxii, but C. fargesii was more sensitive to ABA. The results showed that SKOR expression is consistent with K⁺ efflux and has a positive relationship, with the K⁺ content is negative. ABA can block drought induced-SKOR expression and K⁺ efflux is significantly reduced in C. fargesii.

In summary, we found that root cells of two Catalpa species were damaged under simulated drought conditions, resulting in increased K⁺ efflux under drought treatment. We propose that ABA can improve drought resistance by reducing K⁺ efflux and inhibiting the expression of SKOR and the activity of K⁺ channels. However, we found two patterns, including ABA-dependent and ABA-independent patterns, expressed as different reactions that are resistant and sensitive to drought in two Catalpa species, respectively. In this study, the NMT provided a powerful tool for real-time detection of K⁺ efflux in intact woody roots without damaging cells. In the future, we will apply the NMT with molecular biology methods to reveal the mechanisms by which ABA regulates K⁺ channel genes. For example, scientists have analyzed ABA regulated miRNAs or lncRNAs at the level of transcription during drought.⁴⁵ We expect to improve our understanding of the mechanisms of drought tolerance in tree species of economic importance by combining molecular biology methods with electrophysiological methods.

Disclosure of Potential Conflicts of Interest

No potential conflicts of interest were disclosed.

Abbreviations

ABA	=	Abscisic acid
NMT	=	Non-invasive micro-test technique
TEA	=	Tetraethylammonium
PEG	=	Polyethylene glycol
SKOR	=	Stelar K+ outward-rectifying channel

Supplementary Material

Supplemental data for this article can be accessed on the publisher’s website.

Additional information

Funding

This work was financially supported by the State Key Laboratory of Tree Genetics and Breeding (Northeast Forestry University) [No. K2013103].