Gold nanoparticles synthesized using Panax ginseng leaves suppress inflammatory - mediators production via blockade of NF-κB activation in macrophages

Abstract

In the present study, we report that Gold nanoparticles (AuNPs) synthesized using the leaf extract of Panax ginseng Meyer (P.g AuNPs) exert anti-inflammatory effects through inhibition of downstream NF-κB activation in macrophages. We found that P.g AuNPs reduced the expression of the inflammatory mediators including nitric oxide (NO), prostaglandin E2 (PEG₂), interleukin (IL)-6, tumor necrosis factor-α (TNF-α) was attenuated by P.g AuNPs. Furthermore, P.g AuNPs suppressed lipopolysaccharide (LPS)-induced activation of NF-κB signaling pathway via p38 mitogen-activated protein kinase (MAPK) in RAW 264.7 cells. Taken together, our results suggest that P.g AuNPs can be utilized as a novel therapeutic agent for the prevention and cure of inflammation.

Keywords:

• Inflammation
• P. ginseng
• gold nanoparticles
• green synthesis
• NF-κB

Introduction

Inflammation is a consequence of injured tissues in our body, which are most often associated with cancer, atopic dermatitis (AD), autoimmune disorders and rheumatoid arthritis (RA) (Liu et al. 2012, Rehman et al. 2012). Current therapies for the treatment of inflammatory diseases such as Non-Steroidal Anti-Inflammatory Drugs (NSAIDs) or corticosteroids are mostly used to reduce the symptoms in the short term due to their side effects (Bjarnason et al. 1993, Piper et al. 1991). Therefore, in spite of the relief of symptoms, a cure remains elusive, and treatment of these inflammatory disorders is becoming a major challenge. Macrophages are important cells for maintaining the immune system and are capable of phagocytosis against infectious agents (Chuang et al. 2016, Jeong and Jeong 2010). However, the excessively activated macrophages can aggravate symptoms of the inflammatory process (Ahn et al. 2015).

Lipopolysaccharide (LPS) is a potent activator of multiple inflammatory signaling pathways and induces macrophages to produce a number of inflammatory mediators (Su et al. 2011). NF-κB is transcription factors involved in the expression of immune response mediators and key regulators in a variety of inflammatory diseases, which plays a critical role in the production of pro-inflammatory cytokines including nitric oxide (NO), prostaglandin E2 (PEG2), interleukin (IL)-6, tumor necrosis factor-α (TNF-α), inducible nitric oxide synthase (iNOS), and cyclooxygenase-2 (COX-2) (Ichikawa et al. 2011, Rehman et al. 2012, Wang et al. 2014). In addition, mitogen-activated protein kinases (MAPKs) superfamily such as the p38, extracellular signal regulated kinase (ERK), and c-Jun n-terminal kinase (JNK) have been linked to NF-κB signaling pathways that are downregulated in response to various stimuli (Ahn et al. 2016, Feng et al. 2011, Shan et al. 2009). Thus, controlling NF-κB mechanisms is very important in the development of effective treatments for inflammation.

Gold nanoparticles (AuNPs) have well-known biological applications and have been used therapeutically for drug delivery (Boisselier and Astruc 2009, Naz et al. 2016). Recently, numerous AuNPs of controlled size and shape were synthesized from various materials, and their biological activities were reported (Szelenyi 2012). The studies by Ma et al. (2010) demonstrated that treatment with AuNPs could reduce levels of pro-inflammatory mediators in macrophages (Ma et al. 2010). Several studies have reported that Panax ginseng Meyer possesses potentially beneficial effects on various diseases and human health with few or no side effects (Kang and Min 2012, Siddiqi et al. 2013, Singh et al. 2016). In addition, ginseng leaves have been shown to have anti-cancer, anti-obesity, anti-oxidant, and anti-fatigue properties (Jung et al. 2005, Saito et al. 1973, Singh et al. 2015). We have previously demonstrated eco-friendly methods for the synthesis of AuNPs using the leaf extract of P. ginseng (P.g AuNPs) (Singh et al. 2015). Although the pharmacological effect of P. ginseng leaves and its potential to synthesize nanoparticles has been well explored, however, the anti-inflammatory effect of P.g AuNPs is not studied yet. Considering the pharmacological role of P. ginseng leaves in therapeutic agent, the present study aims at confirming the ability of P.g AuNPs to induce an inflammatory response in macrophages on inflammatory-mediators expression through downregulation of the NF-κB signaling pathway in LPS-induced macrophages.

Materials and methods

Cell culture and reagents

The RAW 264.7 cells, derived from murine macrophage cells (KCLB, Seoul, Korea) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) medium containing 10% heat-inactivated fetal bovine serum (FBS) and 1% penicillin/streptomycin (P/S) in a 37 °C, 5% CO₂ humidified incubator. DMEM was purchased from Gibco-BRL (Grand Island, NY, USA). FBS, P/S, and phosphate-buffered saline (PBS) were obtained from WelGENE Inc. (Daegu, Korea). Antibodies to NF-κB, I-κB, phosphor-IKKα/β (p-IKKα/β), COX-2, iNOS, p-ERK1/2, ERK, p-JNK, JNK, and β-actin were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Antibodies to p38 and p-p38 were obtained from Cell Signaling Technology (Beverly, MA, USA). Recombinant human TNF-α, interferon-gamma (IFN-γ), and horseradish peroxidase (HRP)-conjugated anti-rabbit antibodies were purchased from R&D Systems (Minneapolis, MN, USA). All other chemicals were of reagent grade.

Synthesis of P.g AuNPs by P. Ginseng leaf

According to previous description (Singh et al. 2015), P.g AuNPs was synthesized and using four-year-old P. ginseng leaves, collected from the Gochang, South Korea. After the extraction, 5 mL of leaf extract was mixed with 25 mL of sterile water, and final concentration of 1 mM HAuCl₄˙3H₂O solution was added in the reaction mixture and kept at 80 °C. After the synthesis, the nanoparticles were collected by centrifugation at 16,000 rpm for 25 min. Then, washed thoroughly with sterile water, air dried, and used for further experiments.

Cell viability assay

Cell viability was measured by a 3-(4, 5-dimethyl-2-thiazolyl)-2, 5-diphenyl-2H tetrazolium bromide (MTT) assay (Ahn et al. 2015). RAW 264.7 cells were seeded at a density of 1 × 10⁵ cells per well in 96-well microtiter plates (Corning Costar, Lowell, NY, USA) and grown for 1 day. P.g AuNPs were added to the wells at concentrations ranging between 0 and 200 μg/ml. After 1 day of treatment, 10 μl MTT solution (5 mg/ml) was added to the cells followed by incubation for 4 h. Dimethyl sulfoxide (DMSO) was added to each well to dissolve the generated formazan, and the absorbance was determined at 570 nm using a microplate reader (Bio-Tek Instruments, Inc., Vinooski, VT, USA). Cell viability was determined as a percentage of the control (untreated cells).

Measurement of NO, PGE-2, TNF-α, and IL-6 production

Raw 264.7 macrophages were plated in 96-well plates at 1 × 10⁵ cells/well, pretreated with different concentrations of P.g AuNPs for 1 h, and then stimulated with 1 μg/ml LPS (Sigma-Aldrich, St. Louis, MO, USA) in the presence of P.g AuNPs. After incubation for 24 h, the culture supernatants were collected. Levels of NO were measured using Griess reagents (Sigma-Aldrich, St. Louis, MO, USA). Briefly, 100 μl of each supernatant medium was mixed with an equal volume of Griess reagent, and absorbance was read at 540 nm against a standard curve of sodium nitrite using a Synergy 2 multi-mode microplate reader. Quantification of PGE-2, TNF-α, and IL-6 was performed using an enzyme-linked immunosorbent assay (ELISA) kit (R&D Systems, Minneapolis, MN, USA) according to the protocol supplied by the manufacturer.

Reverse transcription polymerase chain reaction (RT-PCR)

Total cellular RNA was isolated with Trizol LS (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. cDNA was synthesized using a Thermo Scientific cDNA synthesis kit (Lithuania, EU, USA) according to the supplied protocol. Primers were designed for reverse transcription polymerase chain reactions (RT-PCR) for iNOS, COX-2, TNF-α, IL-6, and β-actin. iNOS: ACCCAAGGTCTACGTTCAGG (sense); CGCACATCTCCGCAAATGTA (antisense); COX-2: CCTGAGCATCTACGGTTTGC (sense); ACTGCTCATCACCCCATTCA (antisense); TNF-α: AGGGGAAATGAGAGACGCAA (sense); TTCCCCATCTCTTGCCACAT (antisense); IL-6: CCGGAGAGGAGACTTCACAG (sense); GGAAATTGGGGTAGGAAGGA (antisense); and β-actin ACTCTTCCAGCCTTCCCTCC (sense); CGTACAGGTCTTTGCGGATG (antisense). All reactions were performed in triplicate (Ahn et al. 2015, Siddiqi et al. 2015).

Western blot analysis

To measure protein expression, RAW 264.7 cells were prepared as described previously (Ahn et al. 2016). Protein samples (20 μg) were separated on 8–10% sodium dodecyl sulfate (SDS)-polyacrylamide gels are transferred to nitrocellulose membranes. The membranes were blocked with 5% (w/v) skimmed milk; the membranes were probed with primary antibodies against iNOS, COX-2, MAPKs (p38, ERK, and JNK), NF-κB, I-κB, p- IKKα/β, and β-actin overnight at 4 °C. After washing five times, the blots incubated with HRP-conjugated anti-rabbit antibodies. The blots were analyzed using an enhanced chemiluminescence system (Amersham Biosciences Inc., Piscataway, NJ, USA), followed by exposure to X-ray film (Fuji Photo Film Co., Tokyo, Japan).

Immunofluorescence analysis

RAW 264.7 cells grown overnight on eight-well culture slides (SPL Life Sciences Co., Ltd., Korea) were pretreated with P.g AuNPs for 1 h, then stimulated with LPS for 24 h. Slides were washed three times with PBS and cells were fixed with 3.7% formaldehyde and then permeabilized with 0.5% Triton X-100 for 15 min. The slides were incubated with rabbit monoclonal anti-NF-κB p65 antibody (1:50 dilution, Santa Cruz Biotechnology, Santa Cruz, CA, USA) overnight at 4 °C. Cell were washed three times with PBS, and treated with Alexa Fluor1488 goat anti-rabbit IgG (1:200; Cell Signaling Technology, Beverly, MA, USA) for 1 h. Nuclei were stained with 4′-6-diamidino-2-phenylindole (DAPI) (10 mg/ml; Sigma-Aldrich Co., St. Louis, MO, USA) for 10–15 min. The images were taken using an inverted fluorescence microscope (MDM Instruments, Gyeonggi, Korea) (Ahn et al. 2016, Qi et al. 2011)

Statistical analysis

All data expressed as means ± standard deviations (SD) were either calculated from at least three independent experiments. Student’s t-test and two-way analysis of variance (ANOVA) were used to determine the statistical significance of differences between the treated and untreated (control) groups. Significant differences between two treatment groups were indicated as P < .05, P < .01, and P < .001, respectively.

Results

Effects of P.g AuNPs on viability of RAW 264.7 cells

The MTT assay was used to determine the effects of P.g AuNPs on the cell viability of RAW 264.7 cells. As shown in Figure 1, P.g AuNPs at concentrations ranging from 1 to 200 μg/ml had no effect on the viability of RAW 254.7 cells. Therefore, subsequent experiments were performed using concentrations of 100 μg/ml or lower.

Figure 1. Effect of P.g AuNPs on viability of RAW 264.7 cells. Cells were treated with P.g AuNPs at various concentrations (0, 1, 10, 100, and 200 μg/ml) for 24 h. Cell viability was measured by MTT assay.

Effect of P.g AuNPs on the production of NO and PGE2 in RAW 264.7 cells

Because NO and PGE2 have known to play important roles in the inflammatory-signaling molecules (Su et al. 2011, Tomita et al. 2011), we examined whether NO and PGE2 are suppressed by P.g AuNPs in LPS-stimulated RAW 264.7 cells. As shown in Figure 2(a), LPS (1 μg/ml) considerably increased the concentration of nitrite compared to the basal level without LPS, as measured by the Griess method. The treatment of P.g AuNPs decreased NO production compared to cells treated with LPS alone, until similar level with positive controls. L-NMMA (50 μM) and Bay 11–7082 (10 μM). In addition, RT-PCR and western blotting analysis (Figure 2(b) and (c)) showed that the expression of LPS-induced iNOS’s mRNA and protein levels were significantly decreased by dose-dependent P.g AuNPs treatment. Further, we investigated PGE₂ activity, stimulated by LPS in the presence or absence of P.g AuNPs for 24 h. Treatment of RAW 264.7 cells with P.g AuNPs at different concentrations resulted in dose-dependent decrease in LPS-induced PGE₂ release (Figure 3(a)). In addition, treatment of P.g AuNPs to LPS-stimulated cells had significant effect on gene expression as well as protein levels of COX-2 (Figure 3(b) and (c)). Thus, our results demonstrated that P.g AuNPs strongly suppress the activity of both iNOS and COX-2.

Figure 2. Effects of P.g AuNPs on LPS-induced expression of nitric oxide (NO) production and inducible NO synthase (iNOS) expression in RAW 264.7 cells. (A) NO release, (B) iNOS mRNA expression, (C) iNOS protein were measured in the culture medium of RAW 264.7 cells treated with 1 μg/ml LPS alone or with different concentrations of P.g AuNPs for 24 h. L-NMMA (50 μM) and BAY 11–7082 (10 μM) was used as a positive control drug for NO determination. Values shown are mean ± SEM of three independent experiments. *P < .05, **P < .01 and ***P < .001 versus LPS-treated cells.

Figure 3. Effects of P.g AuNPs on LPS-induced expression of PGE2 production and Cyclooxygenase-2 (COX-2) expression in RAW 264.7 cells. (A) PGE2 production, (B) COX-2 mRNA expression, (C) COX-2 protein were measured in the culture medium of RAW 264.7 cells treated with 1 μg/ml LPS alone or with different concentrations of P.g AuNPs for 24 h. Values shown are mean ± SEM of three independent experiments. *P < .05, **P < .01, and ***P < .001 versus LPS-treated cells.

Effects of P.g AuNPs on the production of TNF-α and IL-6 in LPS-induced RAW 264.7 cells

LPS is a potent stimulator that triggers intracellular signal pathways and has been studied for its role in the production of pro-inflammatory cytokines in macrophages (Choi and Hwang 2004). Various inflammatory mediators are activated through the signaling pathways of their receptors including TNF-α and IL-6. To examine the ability of P.g AuNPs to inhibit inflammatory mediators, we assessed their effects on TNF-α and IL-6 production in LPS-stimulated RAW 264.7 cells. Determination of TNF-α and IL-6 release was assessed by ELISA in LPS-induced RAW 264.7 cells. As shown in Figure 4(a) and (b), P.g AuNPs inhibited LPS-induced TNF-α and IL-6 production in a dose-dependent manner. Subsequently, we investigated the effect of P.g AuNPs on LPS-induced TNF-α and IL-6 gene expression in RAW 264.7 cells. RT-PCR analysis showed that treatment with P.g AuNPs affected the levels of TNF-α and IL-6 in LPS stimulated cell (Figure 4(c) and (d)). Our results clearly showed that P.g AuNPs suppressed the production of TNF-α and IL-6 in LPS-induced RAW 264.7 cells.

Figure 4. Effects of P.g AuNPs on LPS-induced expression of inflammation mediators in RAW 264.7 cells. (A) TNF-α production, (B) IL-6 production, (C) TNF-α mRNA expression, and (D) IL-6 mRNA expression. The mRNA expression data were normalized to the β-actin signal. Values shown are mean ± SEM of three independent experiments. *P < .05, **P < .01, and ***P < .001 versus LPS-treated cells.

Inhibitory effects of P.g AuNPs on LPS-induced NF-κB/p38MAPK activation in RAW 264.7 cells

Numerous studies have reported that the gene expression of cytokines is regulated by NF-κB through the p38 MAPK, and that NF-κB/p38MAPK is a key signaling pathway involved in the expression of inflammation mediators in inflammatory diseases (Feng et al. 2011, Jeong and Jeong 2010, Ma et al. 2010, Wang et al. 2014). We examined whether P.g AuNPs activity was mediated through blockage of NF-κB via p38 MAPK signaling pathways in RAW 264.7 cells by western blot analysis. As shown in Figure 5, stimulation with LPS augmented nuclear translocation of NF-κB in RAW 264.7 cells; however, this effect was suppressed by P.g AuNPs. In addition, the expression of IKK, IκB, p38, ERK, and JNK proteins, which are downregulated by NF-κB responses, was substantially decreased in RAW 264.7 cells (Figures 5 and 6). To further discover the underlying molecular mechanisms contributing to LPS-induced activation of NF-κB in RAW 264.7 cells, we investigated the effect of P.g AuNPs on NF-κB using immunofluorescence. P.g AuNPs inhibited the translocation of NF-κB into the nucleus in RAW 264.7 cells (Figure 7). These findings indicate that P.g AuNPs inhibit NF-κB signaling through the p38 MAPK, resulting in changes on the gene expression changes associated with inflammatory diseases.

Figure 5. Effect of P.g AuNPs on activation of NF-κB signaling molecules and nuclear translocation of NF-κB. RAW 264.7 cells were pretreated with P.g AuNPs at the indicated concentration for 1 h and then exposed to LPS. Cytosolic proteins (phosphorylation of IKK α/β and IκB α/β) were prepared from RAW 264.7 cells and analyzed by Western blotting. Nuclear extracts were prepared from RAW 264.7 cells and analyzed by Western blotting using antibodies against NF-κB. Western blot analysis was independently repeated three times with similar results. *P < .05, **P < .01 and ***P < .001 versus LPS-treated cells.

Figure 6. Effect of ginsenoside P.g AuNPs on LPS-induced phosphorylation of MAPKs in RAW 264.7 cells. Phosphorylation of mitogen-activated protein kinases was determined by Western blotting using a specific antibody against phosphorylated protein. *P < .05, **P < .01, and ***P < .001 versus LPS-treated cells.

Figure 7. P.g AuNPs inhibited the nuclear translocation of NF-κB induced by LPS in RAW 264.7 cells. Cells were incubated with or without 100 μg/ml ginsenoside P.g AuNPs for 1 h and then stimulated with LPS (1 μg/ml) for 30 min. Cells were stained with rabbit anti-NF-κB p65, followed by Alexa Fluor1488 goat anti-rabbit IgG as a secondary antibody. Nuclei were identified using DAPI. Data are representative of three independent experiments.

Discussion

Nanoparticles prepared from different materials have been the fastest growing candidates for drug carriers, cosmetic, and molecular diagnostics in cancer (Bancos et al. 2014, Bhadra et al. 2014). Recent studies have shown that the AuNPs characterized by non-toxic and high absorption (Boisselier and Astruc 2009, Chandran et al. 2006, Hwang et al. 2015).The investigation of the long-term biokinetics, redistribution, and urinary excretion of three different-sized AuNPs in mice confirmed that the AuNPs are mainly excreted in urine without any toxicity (Naz et al. 2016). In addition, it was shown that the AuNPs may be useful to suppress pro-inflammatory mediators in macrophages by blocking the activation of NF-κB and STAT1 (Ma et al. 2010). Especially, biologically synthesized AuNPs using natural products shows diverse advantages among the which present various phytochemicals present in the plant (Chandran et al. 2006, Hwang et al. 2015, Norouz Dizaji et al. 2015). Previously, our studies have established that the synthesis of 10–20 nm AuNPs using the fresh leaf extract of P. ginseng (Singh et al. 2015). P. ginseng has been widely reported to possess pharmacological properties (Siddiqi et al. 2013, Singh et al. 2016) Previous studies have examined the efficacy of P. ginseng against AD in vitro and in vivo. It was shown that Korean red ginseng extract suppressed TNF-α, IL-4, and serum IgE levels in NC/Nga mice (Lee and Cho 2011). The ginseng saponin, ginsenoside Rh1, was shown that to reduce IgE and IL-6 levels and inflammatory symptoms induced by oxazolone in hairless mice (Zheng et al. 2011). In addition, ginsenosides Rh2 and Rg3 were demonstrated for decrease of ear thickness and anti-inflammatory effects in mast cells and animal models (Oh et al. 2014). Furthermore, P. ginseng leaf extract contains several phytochemicals such as ginsenosides, flavonoids, polysaccharides, and triterpenoids, which are responsible for the various pharmacological activities (Jung et al. 2005, Wang et al. 2009). Among ginsenosides, ginsenoside Re, Rd, and Rg1 are known to be mainly present in the ginseng leaves (Kim et al. 2015). Lee et al. have showed that ginsenoside Re may lead to an anti-neuro inflammatory effect on p38 signaling in LPS-induced BV2 microglial cells (Lee et al. 2012). Moreover, Wu et al. indicated that the divergent structure of the ginsenosides including Re, Rd, and Rg1, are responsible for the anti-inflammatory effects in LPS-induced N9 microglial cells by blocking NF-κB signaling pathways. Especially, they have suggested that protopanaxatriol (PPT)-type ginsenosides, including Re and Rg1, may attenuate the neuro-inflammatory activities in central nervous system (CNS) (Wu et al. 2007). Here, we demonstrated the anti-inflammatory effects of eco-friendly synthesized AuNPs using leaf extract of P. ginseng.

Macrophages are capable of phagocytosis, one of the immune defense mechanisms in the body. Another aspect of the inflammatory response is the production of both iNOS and COX-2 through the NF-kB activation (Feng et al. 2011, Jeong and Jeong 2010, Rehman et al. 2012). Our data showed that P.g AuNPs significantly inhibited expression of iNOS and COX-2 at mRNA and protein level in LPS-induced RAW 264.7 macrophage cells, as demonstrated by nitrite production (Figures 2 and 3). These results suggest that P.g AuNPs might block LPS-induced NF-κB activation by inhibiting MAPK/IKK pathways which are related to the degradation of IκBα and their downstream-gene expression such as iNOS and COX-2. Furthermore, treatment of LPS-stimulated RAW 264.7 cells with P.g AuNPs resulted in a significant reduction in inflammatory mediators including TNF-α and IL-6, suggesting potential anti-inflammatory properties of P.g AuNPs. Many studies have shown that NF-κB plays a key role in the inflammatory response through IκB degradation and IκB kinase (IKK) activation. p38 MAPK is known to be involved in intracellular signaling pathways including p38, ERK, and JNK in inflammation, resulting in NF-κB activation in response to different extracellular stimuli such as LPS (Ahn et al. 2016, Su et al. 2011). Based on current knowledge, we examined whether P.g AuNPs have effective anti-inflammatory activities by inhibiting the level of MAPK (p38, ERK, and JNK), IκB, IKK, and NF-κB protein levels in LPS-stimulated macrophage cells (RAW 264.7). Our results showed that pretreatment with P.g AuNPs suppressed production of NF-κB in LPS-induced RAW 264.7 cells through the blockage of p38 MAPK pathways (Figures 5 and 6) and translocation of NF-κB into the nucleus (Figure 7).

Conclusion

In the present study, we elucidated the anti-inflammatory properties of AuNPs synthesized from P. ginseng leaf extract through decreased availability of inflammatory mediators in macrophages. Taken together, our findings support the potential therapeutic application of P.g AuNPs for inflammatory diseases through blockage of NF-κB via p38 MAPK.

Acknowledgements

This research was supported by grant 313038-03-1-SB010 from the Korea Institute of Planning and Evaluation for Technology (iPET) of the Ministry of Food, Agriculture, Forestry and Fisheries, Republic of Korea. The ginseng sample used in this study was provided by the Ginseng Bank of Kyung Hee University.

Disclosure statement

The authors declare that they have no conflicts of interest.