Citations (41)
Keep up to date with the latest research on this topic with citation updates for this article.
Read on this site (13)
Burçak Kurucu, Ali Fettah, Emre Çapkınoğlu, Nergiz Öner, Funda Eren, Özcan Erel, Şule Yeşil & Gürses Şahin. (2022) Dynamic Thiol-Disulfide Homeostasis in Children With β-Thalassemia Trait. Hemoglobin 46:3, pages 164-167.
Read now
Read now
Figen Guzelgul, G. Seyda Seydel & Kiymet Aksoy. (2020) β-Globin Gene Mutations in Pediatric Patients with β-Thalassemia in the Region of Çukurova, Turkey. Hemoglobin 44:4, pages 249-253.
Read now
Read now
Ayşegül Kurtoğlu, Volkan Karakuş, Özgür Erkal & Erdal Kurtoğlu. (2016) β-Thalassemia gene mutations in Antalya, Turkey: results from a single centre study. Hemoglobin 40:6, pages 392-395.
Read now
Read now
Aylla N. L. M. Silva, Greice L. Cardoso, Daniele A. Cunha, Isabela G. Diniz, Sidney E.B. Santos, Gabriela B. Andrade, Saide M.S. Trindade, Maria do Socorro O. Cardoso, Larissa T.V.M. Francês & João F. Guerreiro. (2016) The Spectrum of β-Thalassemia Mutations in a Population from the Brazilian Amazon. Hemoglobin 40:1, pages 20-24.
Read now
Read now
Ferda Ozkinay, Huseyin Onay, Emin Karaca, Esra Arslan, Biray Erturk, Asli Ece Solmaz, Ismihan Merve Tekin, Ozgur Cogulu, Yeşim Aydinok & Canan Vergin. (2015) Molecular Basis of β-Thalassemia in the Population of the Aegean Region of Turkey: Identification of A Novel Deletion Mutation. Hemoglobin 39:4, pages 230-234.
Read now
Read now
Sule Unal, David H.K. Chui, Hong-Yuan Luo, Hamza Okur, Yesim Oymak & Fatma Gumruk. (2015) The First Report of a Homozygous Codons 9/10 (+T) β-Thalassemia Mutation in a Turkish Patient. Hemoglobin 39:1, pages 66-68.
Read now
Read now
Adnan Incebiyik, Ahmet Genc, Nese Gul Hilali, Aysun Camuzcuoglu, Hakan Camuzcuoglu, Avni Kilic & Mehmet Vural. (2014) Prevalence of β-Thalassemia Trait and Abnormal Hemoglobins in Sanliurfa Province in Southeast Turkey. Hemoglobin 38:6, pages 402-404.
Read now
Read now
Ozgur Aldemir, Muzeyyen Izmirli & Hasan Kaya. (2014) The Spectrum of β-Thalassemia Mutations in Hatay, Turkey: Reporting Three New Mutations. Hemoglobin 38:5, pages 325-328.
Read now
Read now
Ahmet Uysal, Ahmet Genc, Nilgün Taşyürek & Bediha Türkyilmaz. (2013) Prevalence of β-Thalassemia Trait and Abnormal Hemoglobin in Premarital Screening in the Province of Izmir, Turkey. Pediatric Hematology and Oncology 30:1, pages 46-50.
Read now
Read now
Ahmet Genc, Deniz Tastemir Korkmaz, Meral Urhan Kucuk, Eyup Rencuzogullari, Selman Atakur, Suleyman Bayram, Muhittin Onderci, Tuba Koc, Sinan Aslan, Abdullah Mutalip, Muslum Faruk, Yusuf Sevgiler & Aygul Tuncdemir. (2012) Prevalence of Beta-Thalassemia Trait and Abnormal Hemoglobins in the Province of Adıyaman, Turkey. Pediatric Hematology and Oncology 29:7, pages 620-623.
Read now
Read now
Ahmet Genc, Deniz Tastemir Korkmaz, Mehmet Buyukleyla & Murat Celiker. (2012) Prevalence and Molecular Analysis of β-Thalassemia in Adiyaman, Turkey. Hemoglobin 36:2, pages 131-138.
Read now
Read now
Inanc Mendilcioglu, Sezin Yakut, Ibrahim Keser, Mehmet Simsek, Akif Yesilipek, Gulseren Bagci & Guven Luleci. (2011) Prenatal Diagnosis of β-Thalassemia and Other Hemoglobinopathies in Southwestern Turkey. Hemoglobin 35:1, pages 47-55.
Read now
Read now
Othman E. Soliman, Sohier Yahia, Amany Shouma, Hala K. Shafiek, Ashraf E. Fouda, Hanan Azzam, Nashwa K. Abousamra, Rabab Mahfouz, Enas F. Goda & Solafa A. El-Sharawy. (2010) Reverse hybridization StripAssay detection of β-thalassemia mutations in northeast Egypt. Hematology 15:3, pages 182-186.
Read now
Read now
Articles from other publishers (28)
Ihab Belmokhtar, Saida Lhousni, Mounia Elidrissi Errahhali, Ayad Ghanam, Manal Elidrissi Errahhali, Zaina Sidqi, Meryem Ouarzane, Majida Charif, Mohammed Bellaoui, Redouane Boulouiz & Noufissa Benajiba. (2022) Molecular heterogeneity of β‐thalassemia variants in the Eastern region of Morocco. Molecular Genetics & Genomic Medicine 10:8.
Crossref
Crossref
Burcu AKINCI, Fatma DEMİR, Ebru TUNCEZ & Özlem ÖZ. (2021) Beta-thalassemia mutation types and the relationship with the demographic factors in Sanliurfa, TurkeyTürkiye, Şanlıurfa’da Beta-Talasemi mutasyon çeşitleri ve demografik faktörlerle ilişkisi. Family Practice and Palliative Care 6:3, pages 105-110.
Crossref
Crossref
Ahmet Kursad Gunes & Hilmi Erdem Gozden. (2021) The Spectrum of Beta-Thalassemia Mutations in Syrian Refugees and Turkish Citizens. Cureus.
Crossref
Crossref
Abdullah Arpaci, Bahar Unlu Gul, Oguzhan Ozcan, Gul Ilhan, Cigdem El, Emre Dirican, Sibel Elmacioglu & Hasan Kaya. (2021) Presentation of two new mutations in the 3′untranslated region of the β-globin gene and evaluating the molecular spectrum of thalassemia mutations in the Mediterranean region of Turkey. Annals of Hematology 100:6, pages 1429-1438.
Crossref
Crossref
Ebru Yilmaz Keskin, Öznur Acar & Halil Özbas. (2021) Missed Diagnosis of β-Thalassemia Trait in Premarital Screening Due to Accompanying HbA2-Yialousa (HBD: c.82G>T). Journal of Pediatric Hematology/Oncology 43:1, pages e103-e104.
Crossref
Crossref
Tabish QidwaiTabish Qidwai. 2021. Exploration of Host Genetic Factors associated with Malaria. Exploration of Host Genetic Factors associated with Malaria
43
53
.
Gonul Aydogan, Salim Keskin, Ferhan Akici, Zafer Salcioglu, Cengiz Bayram, Ezgi P. Uysalol, Tuba N.T. Gucer, Gizem Ersoy & Nihal Ozdemir. (2019) Causes of Hypochromic Microcytic Anemia in Children and Evaluation of Laboratory Parameters in the Differentiation. Journal of Pediatric Hematology/Oncology 41:4, pages e221-e223.
Crossref
Crossref
Arzu Yazal Erdem, Fatma Demir Yenigürbüz, Esra Pekpak, Burcu Akıncı, Elif Aktekin, Cengiz Bayram, Zeynep Yıldız Yıldırmak, Eda Ataseven, Sinan Akbayram, İlgen Şaşmaz, Başak Taburoğlu Yılmaz, Ayşe Özkan, Sibel Akpınar Tekgündüz, Doğan Köse, Tuba Karapınar, Mustafa Büyükavcı, Ertan Sal, Turan Bayhan, Serap Kirkiz, Şule Ünal, Raziye Canan Vergin, Metin Çil, Barış Malbora, Ali Ayçiçek, Hüsniye Neşe Yaralı & Namık Yaşar Özbek. (2019) Refugee children with beta‐thalassemia in Turkey: Overview of demographic, socioeconomic, and medical characteristics. Pediatric Blood & Cancer 66:5, pages e27636.
Crossref
Crossref
Hatice Çevirici, Can Acıpayam, Ebru Dündar Yenilmez, Fatma Burcu Belen, Esra Pekpak, Yöntem Yaman & Abdullah Tuli. (2019) Investigation of beta globin gene mutations in Syrian refugee patients with thalassemia major. Turkish Journal of Biochemistry 44:2, pages 126-129.
Crossref
Crossref
Guluzar Ozbolat & Abdullah Tuli. (2018) Hematologic features of beta-globin gene mutation type (?o) with homozygous beta thalassemia. The Ukrainian Biochemical Journal 90:4, pages 115-120.
Crossref
Crossref
L. C. Rizo‐de‐la‐Torre, B. Ibarra, J. Y. Sánchez‐López, M. T. Magaña‐Torres, V. M. Rentería‐López & F. J. Perea‐Díaz. (2017)
Three novel
HBB
mutations, c.‐140C>G (‐90 C>G), c.237_256del
GGACAACCTCAAGGGCACCT
(
FS
Cd 78/85 ‐20 bp), and c.315+2T>G (
IVS
2:2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients
. International Journal of Laboratory Hematology 39:5, pages 539-545.
Crossref
Crossref
Nikolaos Sousos, Despoina Adamidou, Philippos Klonizakis, Alexandra Agapidou, Stamatia Theodoridou, Georgios Spanos, Kyriakos Psarras, Evaggelia Vetsiou, Timoleon-Achilleas Vyzantiadis & Efthymia Vlachaki. (2017) Presence of the IVS-I-6-Mutated Allele in Beta-Thalassemia Major Patients Correlates with Extramedullary Hematopoiesis Incidence. Acta Haematologica 137:3, pages 175-182.
Crossref
Crossref
Ahmad N. Hasan & Mustafa S. Al-Attar. Molecular investigations of β-thalassemic children in Erbil governorate. Molecular investigations of β-thalassemic children in Erbil governorate.
Serdar Öztuzcu, Ali Bay, Gülper Nacarkahya, Mustafa Ulaşlı, Elif Aktekin, Sinan Akbayram, Murat Korkmaz, Füsun Taşgül & Ahmet Arslan. (2016) Investigation of Distribution of Beta -Thalassemia Hereditary Mutations in Gaziantep and the Surrounding Areas. Journal of Clinical and Experimental Investigations 7:4.
Crossref
Crossref
A Uludağ, A Uysal, A Uludağ, YH Ertekin, M Tekin, B Kütük, F Silan & Ö Özdemir. (2016) Prevalence and mutations of β-thalassemia trait and abnormal hemoglobins in premarital screening in Çanakkale province, Turkey. Balkan Journal of Medical Genetics 19:1, pages 29-34.
Crossref
Crossref
Mohamad Moghadam, Mehran Karimi, Seyed Javad Dehghani, Javad Dehbozorgian, Somaye Montazeri, Elham Javanmardi, Rahimeh Asadzade, Azizollah Amiri, Zahra Saghatoleslam, Fatemosadat Sotodegan, Nazila Morshedi, Jaber Imanifard & Abdolreza Afrasiabi. (2015)
Effectiveness of
β
-thalassemia prenatal diagnosis in Southern Iran: a cohort study
. Prenatal Diagnosis 35:12, pages 1238-1242.
Crossref
Crossref
Hüseyin Onay, Ayça Aykut, Emin Karaca, Asude Durmaz, Aslı Ece Solmaz, Özgür Çoğulu, Yeşim Aydınok, Canan Vergin & Ferda Özkınay. (2015) Molecular spectrum of α-globin gene mutations in the Aegean region of Turkey: first observation of three α-globin gene mutations in the Turkish population. International Journal of Hematology 102:1, pages 1-6.
Crossref
Crossref
Mustafa Ulasli, Serdar Oztuzcu, Sevil Kirkbes, Ali Bay, Yusuf Ziya Igci, Recep Bayraktar, Mehri Igci, Sercan Ergun, Ecir Ali Cakmak, Elif Aytekin & Ahmet Arslan. (2014) Novel Βeta (β)-Thalassemia Mutation in Turkish Children. Indian Journal of Hematology and Blood Transfusion 31:2, pages 218-222.
Crossref
Crossref
Adil A. Eissa, Muna A. Kashmoola, Sulav D. Atroshi & Nasir A. S. Al-Allawi. (2014) Molecular Characterization of β-Thalassemia in Nineveh Province Illustrates the Relative Heterogeneity of Mutation Distributions in Northern Iraq. Indian Journal of Hematology and Blood Transfusion 31:2, pages 213-217.
Crossref
Crossref
Ammar D. Elmezayen, Samia M. Kotb, Nadia A. Sadek & Ebtesam M. Abdalla. (2015) β-Globin Mutations in Egyptian Patients With β-Thalassemia. Laboratory Medicine 46:1, pages 8-13.
Crossref
Crossref
Tanya Milachich, Tanya Timeva, Cumhur Ekmekci, Cagri Beyazyurek, Huseyin Avni Tac, Atanas Shterev & Semra Kahraman. (2013) Birth of a healthy infant after preimplantation genetic diagnosis by sequential blastomere and trophectoderm biopsy for β-thalassemia and HLA genotyping. European Journal of Obstetrics & Gynecology and Reproductive Biology 169:2, pages 261-267.
Crossref
Crossref
Semra Kahraman, Cagri Beyazyurek & Cumhur Gokhan Ekmekci. (2011) Seven years of experience of preimplantation HLA typing: a clinical overview of 327 cycles. Reproductive BioMedicine Online 23:3, pages 363-371.
Crossref
Crossref
Ozgur Cogulu, Ferda Ozkinay, Haluk Akin, Huseyin Onay, Emin Karaca, Asude Alpman Durmaz, Burak Durmaz, Ayca Aykut, Erhan Pariltay, Ozgur Kirbiyik, Cumhur Gunduz & Cihangir Ozkinay. (2011) Reasons for Adult Referrals for Genetic Counseling at a Genetics Center in Izmir, Turkey: Analysis of 8965 Cases over an Eleven‐Year Period. Journal of Genetic Counseling 20:3, pages 287-293.
Crossref
Crossref
Antonino Giambona, Margherita Vinciguerra, Monica Cannata, Filippo Cassarà, Germana Fiorentino, Filippo Leto, Pina Lo Gioco, Disma Renda, Cristina Passarello & Aurelio Maggio. (2011) The genetic heterogeneity of β-globin gene defects in Sicily reflects the historic population migrations of the island. Blood Cells, Molecules, and Diseases 46:4, pages 282-287.
Crossref
Crossref
Turker Bilgen, Yunus Arikan, Duran Canatan, Akif Yeşilipek & Ibrahim Keser. (2011) The association between intragenic SNP haplotypes and mutations of the beta globin gene in a Turkish population. Blood Cells, Molecules, and Diseases 46:3, pages 226-229.
Crossref
Crossref
A. Nazli Basak & Sukru Tuzmen. 2011. Disease Gene Identification. Disease Gene Identification
291
307
.
Martin H. Steinberg, Bernard G. Forget, Douglas R. Higgs & David J. WeatherallSwee Lay Thein & William G. Wood. 2010. Disorders of Hemoglobin. Disorders of Hemoglobin
323
356
.
Martin H. Steinberg, Bernard G. Forget, Douglas R. Higgs & David J. Weatherall. 2010. Disorders of Hemoglobin. Disorders of Hemoglobin
321
322
.