Publication Cover
Hemoglobin
international journal for hemoglobin research
Volume 33, 2009 - Issue 3-4
114
Views
15
CrossRef citations to date
0
Altmetric
Original Article

Molecular Heterogeneity of β-Thalassemia Alleles in Spain and its Importance in the Diagnosis and Prevention of β-Thalassemia Major and Sickle Cell Disorders

, &
Pages 226-234 | Received 21 Jan 2009, Accepted 17 Feb 2009, Published online: 15 Sep 2009

Keep up to date with the latest research on this topic with citation updates for this article.

Read on this site (3)

Juan A. Orts, Ángel Zúñiga, Yanis Bello, Aleix B. Fabregat & Ana I. Vicente. (2016) Hb A1c Determination by Capillary Electrophoresis is an Efficient Method for Detecting β-Thalassemias and Hemoglobin Variants. Hemoglobin 40:5, pages 335-340.
Read now
Sandra S. Lazarte, María E. Mónaco, Ana C. Haro, Cecilia L. Jiménez, Myriam E. Ledesma Achem & Blanca A. Issé. (2014) Molecular Characterization and Phenotypical Study of β-Thalassemia in Tucumán, Argentina. Hemoglobin 38:6, pages 394-401.
Read now

Articles from other publishers (12)

Ekta Rao, Sandip Kumar Chandraker, Mable Misha Singh & Ravindra Kumar. (2024) Global distribution of β-thalassemia mutations: An update. Gene 896, pages 148022.
Crossref
Ihab Belmokhtar, Saida Lhousni, Mounia Elidrissi Errahhali, Ayad Ghanam, Manal Elidrissi Errahhali, Zaina Sidqi, Meryem Ouarzane, Majida Charif, Mohammed Bellaoui, Redouane Boulouiz & Noufissa Benajiba. (2022) Molecular heterogeneity of β‐thalassemia variants in the Eastern region of Morocco. Molecular Genetics & Genomic Medicine 10:8.
Crossref
Johannes J M L Hoffmann & Eloísa Urrechaga. (2020) Verification of 20 Mathematical Formulas for Discriminating Between Iron Deficiency Anemia and Thalassemia Trait in Microcytic Anemia. Laboratory Medicine 51:6, pages 628-634.
Crossref
Eduardo J. Bardón Cancho, Marina García-Morín, Cristina Beléndez, Pablo Velasco, David Benéitez, Anna Ruiz-Llobet, Rubén Berrueco, Bienvenida Argilés, Áurea Cervera, José Antonio Salinas, Cruz Vecilla, Ainhoa Gondra, Griselda Vallés, Thais Murciano, Mar Bermúdez & Elena Cela. (2020) Actualización del registro español de hemoglobinopatías de niños y adultos. Medicina Clínica 155:3, pages 95-103.
Crossref
Eduardo J. Bardón Cancho, Marina García-Morín, Cristina Beléndez, Pablo Velasco, David Benéitez, Anna Ruiz-Llobet, Rubén Berrueco, Bienvenida Argilés, Áurea Cervera, José Antonio Salinas, Cruz Vecilla, Ainhoa Gondra, Griselda Vallés, Thais Murciano, Mar Bermúdez & Elena Cela. (2020) Update of the Spanish registry of haemoglobinopathies in children and adults. Medicina Clínica (English Edition) 155:3, pages 95-103.
Crossref
Paloma Ropero, Sara Erquiaga, Beatriz Arrizabalaga, Germán Pérez, Silvia de la Iglesia, María José Torrejón, Celia Gil, Cela Elena, María Tenorio, Jorge M Nieto, Félix de la Fuente-Gonzalo, Ana Villegas, Fernando-Ataúlfo González Fernández & Rafael Martínez. (2017) Phenotype of mutations in the promoter region of the β-globin gene. Journal of Clinical Pathology 70:10, pages 874-878.
Crossref
L. C. Rizo‐de‐la‐Torre, B. Ibarra, J. Y. Sánchez‐López, M. T. Magaña‐Torres, V. M. Rentería‐López & F. J. Perea‐Díaz. (2017) Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256del GGACAACCTCAAGGGCACCT ( FS Cd 78/85 ‐20 bp), and c.315+2T>G ( IVS 2:2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients . International Journal of Laboratory Hematology 39:5, pages 539-545.
Crossref
Elena Cela, José M. Bellón, María de la Cruz, Cristina Beléndez, Rubén Berrueco, Anna Ruiz, Izaskun Elorza, Cristina Díaz de Heredia, Aurea Cervera, Griselda Vallés, J. Antonio Salinas, M. Teresa Coll, Mar Bermúdez, Marta Prudencio, Bienvenida Argilés & Cruz Vecilla. (2017) National registry of hemoglobinopathies in Spain (REPHem). Pediatric Blood & Cancer 64:7, pages e26322.
Crossref
Susana Rives Solà. (2013) Enfermedad de células falciformes: papel del pediatra. Anales de Pediatría Continuada 11:3, pages 123-131.
Crossref
H López‐Escribano, MM Parera, P Guix, JM Serra, A Gutierrez, D Balsells, E Oliva‐Berini, JA Castro, MM Ramon & A Picornell. (2012) Balearic archipelago: three islands, three beta‐thalassemia population patterns. Clinical Genetics 83:2, pages 175-180.
Crossref
Antonino Giambona, Margherita Vinciguerra, Monica Cannata, Filippo Cassarà, Germana Fiorentino, Filippo Leto, Pina Lo Gioco, Disma Renda, Cristina Passarello & Aurelio Maggio. (2011) The genetic heterogeneity of β-globin gene defects in Sicily reflects the historic population migrations of the island. Blood Cells, Molecules, and Diseases 46:4, pages 282-287.
Crossref
Turker Bilgen, Yunus Arikan, Duran Canatan, Akif Yeşilipek & Ibrahim Keser. (2011) The association between intragenic SNP haplotypes and mutations of the beta globin gene in a Turkish population. Blood Cells, Molecules, and Diseases 46:3, pages 226-229.
Crossref

Reprints and Corporate Permissions

Please note: Selecting permissions does not provide access to the full text of the article, please see our help page How do I view content?

To request a reprint or corporate permissions for this article, please click on the relevant link below:

Academic Permissions

Please note: Selecting permissions does not provide access to the full text of the article, please see our help page How do I view content?

Obtain permissions instantly via Rightslink by clicking on the button below:

If you are unable to obtain permissions via Rightslink, please complete and submit this Permissions form. For more information, please visit our Permissions help page.