Interactions between starch source and gelatinisation degree on performance and small intestinal digestion in broiler chickens

Figures & data

Table 1. Analysed chemical composition (g/kg) of the wheat, dehulled faba bean parent meal (FBPM), and the air-classified faba bean starch-rich fraction (FBS)

Item	Wheat	FBPM	FBS
Dry matter	895	860	902
Crude protein	122	276	159
Starch	597	309	672
Ether extract	12.2	17.5	7.2
NDF	95	48.6	19.6

Figure 1. Particle-size distribution of the starch sources. Volume weighted mean: 50 µm for the FBS and 240 µm for the wheat. Surface weighted mean: 21 µm for the FBS and 26 µm for the wheat

Table 2. Experimental diet composition, analysed and calculated nutrient content

Ingredients, g/kg (as fed)	Cereal	Legume
Wheat	582	–
Faba bean starch (FBS)	–	512
Soybean meal^1 (44% CP)	274	275.6
Cellulose powder^2	–	70
Rapeseed oil	75	76
Limestone	14.77	15.04
Monocalcium phosphate	16.79	22.28
L-Lysine	8	1
DL-Methionine	6.09	5.61
L-Threonine	4	3.6
Sodium chloride	4.76	4.29
Titanium dioxide	5	5
Choline chloride	1.96	1.95
Mineral & Vitamin premix^3	6.13	6.13
Enzyme (Rovabio)^4	1.5	1.5
Analysis	Pelleted – Extruded	Pelleted – Extruded
Dry matter	904–934	906–923
Starch gelatinisation^5	209–715	207–943
Gross energy (MJ/kg DM)	19.76	19.77
Starch (g/kg DM)	370	374
Crude protein (g/kg DM)	239	237
Ether extract (g/kg DM)	90	90
NDF (g/kg DM)	110	118
Calculated nutrient content
Metabolisable energy (MJ/kg)	12.71	12.71
Calcium (g/kg)	9.7	10.5
Available Phosphorous (g/kg)	5.0	5.4

¹Ground to pass a 1-mm screen.

²SANACEL® 150, CFF GmbH & Co. KG, Gehren. Germany.

³Mineral and vitamin premix provided the following per kg diet: Fe, 50 mg; Mn, 122 mg; Zn, 80 mg; Cu, 14 mg; I, 0 · 72 mg; Se, 0 · 28 mg, retinyl acetate, 5.72 mg; cholecalciferol, 0.15 mg; dl-α-tocopheryl acetate, 78 mg; menadione, 8 mg; thiamine, 5 mg; riboflavin, 24 mg; niacin, 32 mg; calcium pantothenate, 24 mg; pyridoxine, 13 mg; cobalamin, 0.03 mg; biotin, 0.5 mg; folic acid, 4 mg.

⁴Enzyme Rovabio Excel Ap T-Flex, Adisseo, France provided the following per kg diet: Endo-1,4-β-xylanase: 33 000 visco units; Endo-1,3(4)-β-glucanase: 45 000 visco units; Endo-1,4-β-glucanase (cellulase) >9600 DNS units + 16 other enzyme activities obtained from a fermentation broth of Penicillium funiculosum.

⁵Starch gelatinisation: g/kg of total starch.

Table 3. Analysed amino acid¹ composition (g/kg DM) of the diets

	Cereal	Legume
Essential amino acids
Arginine	12.5	15.0
Histidine	4.6	5.0
Isoleucine	7.6	8.1
Leucine	13.7	14.5
Lysine	16.3	15.1
Methionine	7.8	7.9
Phenylalanine	9.2	9.4
Threonine	9.6	10.3
Valine	8.4	9.0
Non-essential amino acids
Alanine	6.4	7.10
Aspartic acid	18.3	21.8
Cystein	2.6	2.5
Glutamic acid	41.4	37.5
Glycine	6.7	7.2
Proline	12.3	10.2
Serine	8.8	9.3
Tyrosine	4.6	5.2
Total amino acid	190.8	195.1

¹Determined using water-corrected molecular weights.

Table 4. Sequences of primers used for quantitative real-time PCR

Gene1	F/R	Primer sequence (5’ to 3’)	Product size (bp)	Gene ID	Reference
GAPDH	F:	GAGGGTAGTGAAGGCTGCTG	113	NM 204 305.1	Dalgaard et al. (2015)
	R:	CATCAAAGGTGGAGGAATGG
HMBS	F:	GGCTGGGAGAATCGCATAGG	131	XM_004947916.3	Teng et al. (2020)
	R:	TCCTGCAGGGCAGATACCAT
GLUT1 (SLC2A1)	F:	TCCTCCTGATCAACCGCAAT	65	NM_205209.1	Kheravii et al. (2018)
	R:	TGTGCCCCGGAGCTTCT
GLUT2 (SLC2A2)	F:	TGATCGTGGCACTGATGGTT	171	NM_207178.1	Kheravii et al. (2018)
	R:	CCACCAGGAAGACGGAGATA
SGLT1 (SLC5A1)	F: R:	TGTCTCTCTGGCAAGAACATGTC GGGCAAGAGCTTCAGGTATCC	72	XM_015275173.2	Mott et al. (2008)

GAPDH: glyceraldehyde 3-phosphate dehydrogenase; HMBS: hydroxymethylbilane synthase;

GLUT1 (SLC2A1): glucose transporter 1; GLUT2 (SLC2A2): glucose transporter 2; SGLT1(SLC5A1) sodium glucose transporter 1.

Table 5. The effect of starch source and processing method on the growth performance¹ of male broilers from 17 to 29 d

Starch source	Processing	BWG^2 (g)	FI^2 (g)	FCR^2 (g/g)
Wheat	Pelleting	1510	1919 b	1.276
FBS	Pelleting	1509	1956 b	1.297
Wheat	Extrusion	1562	1940 b	1.247
FBS	Extrusion	1601	2067 a	1.292
	√MSE*	100.84	65.80	0.06
Starch source
Wheat		1536	1930	1.262
FBS		1555	2012	1.295
Processing
Pelleting		1510	1938	1.287
Extrusion		1582	2004	1.269
P-value
Starch source		0.546	<0.001	0.080
Processing		0.032	0.003	0.375
Starch source x Processing		0.541	0.042	0.529

¹Values are means of 10 replicate pens of 5 birds each.

²Body weight gain; feed intake and feed conversion ratio.

^*√MSE: square root of means square error in the analysis of variance.

FBS: Faba bean starch-rich fraction.a, b: Means within column followed by different letters are significantly different (P < 0.05).

Table 6. The effect of starch source and processing method on starch digestibility along the intestinal tract of 30-d-old male broilers^1.

		Jejunum		Ileum
Starch source	Processing	Upper	Lower	Upper	Lower
Wheat	Pelleting	0.921 a	0.947	0.981 a	0.998 a
FBS	Pelleting	0.826 b	0.912	0.940 b	0.972 c
Wheat	Extrusion	0.879 a, b	0.973	0.994 a	0.994 a, b
FBS	Extrusion	0.902 a	0.971	0.985 a	0.987 b
	√MSE*	0.051	0.027	0.020	0.006
Starch source
Wheat		0.900	0.960	0.988	0.996
FBS		0.864	0.942	0.962	0.980
Processing
Pelleting		0.873	0.930	0.959	0.985
Extrusion		0.891	0.972	0.989	0.991
P-value
Starch source		0.032	0.038	0.001	<0.001
Processing		0.299	<0.001	<0.001	0.009
		0.001	0.057	0.018	<0.001

¹Values are means of 10 replicate pens (pooled samples from two birds/pen).

*√MSE: square root of means square error in the analysis of variance.

a, b, c: Means within column followed by different letters are significantly different (P < 0.05).

Figure 2. a) Light microscopy images showing starch granules (black dots) in digesta from the upper and lower jejunum (Uj, Lj) and ileum (Ui, Li) collected from birds fed pelleted diets based on either wheat or faba bean starch (FBS). Each column represents one replicate pen with samples collected from one bird per pen. Magnification x 10. b) Light microscopy images showing starch granules (black dots) in digesta from the upper and lower jejunum (Uj, Lj) and ileum (Ui, Li) collected from birds fed extruded diets based on either wheat or faba bean starch (FBS). Each column represents one replicate pen with samples collected from one bird per pen. Magnification x 10

Table 7. The effect of starch source and processing method on the expression¹ of glucose transporter 1 (GLUT1), glucose transporter 2 (GLUT2) and sodium glucose transporter 1 (SGLT1) in the upper jejunum of 30-d-old male broilers.²

Starch source	Processing	GLUT1	GLUT2	SGLT1
Wheat	Pelleting	1.000	1.000	1.000
FBS	Pelleting	0.825	1.217	0.928
Wheat	Extrusion	1.409	2.187	1.358
FBS	Extrusion	1.511	1.762	1.373
	√MSE*	0.265	0.865	0.555
Starch source
Wheat		1.205	1.594	1.179
FBS		1.168	1.489	1.150
Processing
Pelleting		0.912	1.108	0.964
Extrusion		1.460	1.975	1.365
P-value
Starch source		0.697	0.735	0.884
Processing		<0.001	0.008	0.050
Starch source x Processing		0.150	0.303	0.826

¹Data are expressed as a ratio of the control group (Wheat-Pelleting) value set to 1.000.

²Values are means of eight replicate pens (samples from one bird per pen).

*√MSE: square root of means square error in the analysis of variance.

Table 8. The effect of starch source and processing method on the apparent nitrogen digestibility along the intestinal tract of 30-d-old male broilers.¹

		Jejunum		Ileum
Starch source	Processing	Upper	Lower	Upper	Lower
Wheat	Pelleting	0.370	0.582	0.711	0.813
FBS	Pelleting	0.305	0.552	0.735	0.832
Wheat	Extrusion	0.255	0.538	0.737	0.823
FBS	Extrusion	0.254	0.588	0.733	0.848
	√MSE*	0.096	0.068	0.046	0.030
Starch source
Wheat		0.309	0.560	0.725	0.818
FBS		0.279	0.570	0.734	0.840
Processing
Pelleting		0.338	0.567	0.724	0.822
Extrusion		0.255	0.563	0.735	0.836
P-value
Starch source		0.341	0.651	0.537	0.027
Processing		0.012	0.853	0.437	0.170
	0.298		0.074	0.346	0.774

¹Values are means of 10 replicate pens (pooled samples from two birds/pen).^*√MSE: square root of means square error in the analysis of variance.

Table 9. The effect of starch source and processing method on the ratios of starch and nitrogen disappearance rates (SNDR) along the intestinal tract of 30-d-old male broilers.¹

		Jejunum		Ileum
Starch source	Processing	Upper	Lower	Upper	Lower
Wheat	Pelleting	25.4	15.9	13.4 b	12.0 b
FBS	Pelleting	27.8	15.8	12.1 c	11.0 c
Wheat	Extrusion	44.1	20.5	15.2 a	13.6 a
FBS	Extrusion	49.4	19.8	16.0 a	13.8 a
	√MSE*	15.86	2.04	0.90	0.43
Starch source
Wheat		35.8	18.3	14.4	12.8
FBS		39.2	17.8	14.1	12.4
Processing
Pelleting		26.7	15.9	12.7	11.5
Extrusion		46.8	20.2	15.6	13.7
P-value
Starch source		0.456	0.590	0.526	0.012
Processing		<0.001	<0.001	<0.001	<0.001
		0.781	0.665	<0.001	<0.001

¹Values are means of 10 replicate pens (pooled samples from two birds/pen).

^*√MSE: square root of means square error in the analysis of variance.

a, b, c: Means within column followed by different letters are significantly different (P < 0.05).

Table 10. The effect of starch source and processing method on the activities of digestive enzymes (U/g chyme) in the digesta collected from the lower jejunum of 30-d-old male broilers.¹

Starch source	Processing	Amylase	Trypsin
Wheat	Pelleting	64.7	4.1
FBS	Pelleting	82.9	3.1
Wheat	Extrusion	54.8	4.8
FBS	Extrusion	77.1	3.9
	√MSE^*	32.21	0.92
Starch source
Wheat		59.7	4.4
FBS		80.0	3.5
Processing
Pelleting		73.8	3.6
Extrusion		66.0	4.3
P-value
Starch source		0.055	0.003
Processing		0.444	0.019
Starch source x Processing		0.840	0.959

¹Values are means of 10 replicate pens (samples from one bird per pen).

^*√MSE: square root of means square error in the analysis of variance.

Dalgaard, T. S., K. Skovgaard, L. R. Norup, J. Pleidrup, A. Permin, T. W. Schou, D. F. Vadekær, G. Jungersen, and H. R. Juul-Madsen. 2015. “Immune Gene Expression in the Spleen of Chickens Experimentally Infected with Ascaridia Galli.” Veterinary Immunology and Immunopathology 164 (1–2): 79–86. doi:10.1016/j.vetimm.2015.01.003.

 PubMed Web of Science ®Google Scholar

Teng, P.-Y., S. Yadav, F. L. De Souza Castro, Y. H. Tompkins, A. L. Fuller, and W. K. Kim. 2020. “Graded Eimeria Challenge Linearly Regulated Growth Performance, Dynamic Change of Gastrointestinal Permeability, Apparent Ileal Digestibility, Intestinal Morphology, and Tight Junctions of Broiler Chickens.” Poultry Science 99 (9): 4203–4216. doi:10.1016/j.psj.2020.04.031.

 Web of Science ®Google Scholar

Kheravii, S. K., R. A. Swick, M. Choct, and S.-B. Wu. 2018. “Upregulation of Genes Encoding Digestive Enzymes and Nutrient Transporters in the Digestive System of Broiler Chickens by Dietary Supplementation of Fiber and Inclusion of Coarse Particle Size Corn.” BMC Genomics 19 (1): 208. doi:10.1186/s12864-018-4592-2.

 PubMedGoogle Scholar

Mott, C., P. Siegel, K. Webb JR, and E. Wong. 2008. “Gene Expression of Nutrient Transporters in the Small Intestine of Chickens from Lines Divergently Selected for High or Low Juvenile Body Weight.” Poultry Science 87 (11): 2215–2224. doi:10.3382/ps.2008-00101.

 PubMed Web of Science ®Google Scholar