Genetic diversity of Verticillium dahliae from olive trees in Tunisia based on RAMS and IGS-RFLP analyses

Figures & data

Table 1. Verticillium dahliae isolates collected from olive tree (Olea europea) in Tunisia.

Geographic origin	Year	Colony colour	Colony texture	Colony shape	Microsclerotia	Isolates
Kairouan (Chbika)	2011	MW	SF	SD	(+)	Vk1.1, Vk1.3, VK1.2
Kasserine	unk	MW	DM	ND	–	Vk1.11, Vk6/11, Vk3/11, Vk2/11
	unk	MW	SF	ND	–	Vdks5, VdKS6, VdkS3
Mahdia	2011	MW	SF	ND	–	Vmh3.2
Monastir (Boumerdes)	2011	W-G	SF	ND	(+++)	Vms3.2, Vms3.3
Monastir (Sahline)	2011	MW	DM	ND	–	Vsh1.2, Vsh
Monastir (Zarmdine)	unk	MW	DM	ND	(+)	Zarmdine, Vz17
Sfax (Sidi-Bouakazine)	2009	MW	DM	ND	–	V30
	2010	MW	SF	SD	(+)	Bk2
	2011	MW	DM	ND	–	Vs1.2 T, Vs1.2ch
	2011	MW	DM	ND	(++)	Vs1.1ch, Vs1.1G
	2011	MW	SF	ND	–	Vs3.1F, Vs3.3F
	unk	MW	DM	ND	(++)	Bakt3, Bakt7, Bakt11
	unk	MW	SF	SD	–	Vhammadi
Sidi-Bouzid (Souk-jdid)	2011	W-G	SF	SD	(+)	Vsb.P*
	2011	W-G	SF	SD	(++)	Vsbp7*
	2011	MW	SF	SD	(++)	Vsb1.2, Vsb1.3, Vsb1.4
	2011	W-G	SF	SD	(+)	Vsb1.1
Sousse (Chott-Mariem)	2011	MW	SF	ND	(+)	Vcm2
Zaghouan (Nadhour)	2011	MW	SF	LD	(++)	Vd2, Vd3, Vd4
unk	unk	MW	SF	SD	–	Vfa2, VDOR
unk	unk	W-G	SF	SD	(+++)	Vms2

MW: Milky white; W-G: White to greyish; SF: Slightly Flocculose; DM: Dense mycelium; SD: Small dome; ND: No dome; LD: Low dome, unk: unknown; +++: High production ; ++: Moderate production; + : Low production ; –: No production; all isolates were recovered from stem tissues, except Vsb.P and Vsbp7.

Table 2. List of amplified genomic regions and primers.

Genomic region	Primer	Sequence	Reference
ITS	Vd1	5’- CCGGTCCATCAGTCTCTCTG	Nazar et al. (1991)
Entire IGS	Vd2	5’- ACTCCGCATCAGTCTCTCCTG	Appel & Gordon (1995)
	CNS1	5’- CTGAACGCCTCTAAGTCAG
	CNL12	5’- GAGACAAGCATATGACTACTG
RAMS	GT primer	5’-YHY(GT)5G	Hantula et al. (1996)
	CCA primer	5’-DDB(CCA)5
	CGA primer	5’-DHB(CGA)5
	ACA primer	5’-BDB(ACA)5
	GAAA primer	5’-BBBG(GAAA)3GAA

The following designations are used for degenerate sites: H (A, T or C), B (G, T or C), Y (G, A or C) and D (G, A or T).

Fig. 1 (Colour online) Morphological characteristics of different V. dahliae morphotypes cultured on PDA for 15 days at 25 °C. A: Morphotype 1 with milky white and flocculose mycelium; B: Morphotype 2 with greyish-white surface; C: Morphology of conidiophores, phialides and conidia of V. dahliae; D: pure culture of V. dahliae.

Fig. 2 Gel electrophoresis of the amplified rDNA internal transcribed spacer (ITS) specific region of Verticillium dahliae isolates. Lanes 1–16 are loaded as follows: DNA size marker, PCR products of Vsb 1.2, VSBP7, Vms 3.3, Vmh3.2, VK1.11, Vk1.3, Vcm2, V.hmd, VSB1.1, V30, Vd4, Vz17, VS 1.1G, Vms 3.2, and negative control.

Fig. 3 Disease severity (DS) of V. dahliae isolates recovered from olive trees in Tunisia (histograms denoted by the same letter are not significantly different according to LSD test; α ≤ 0.05).

Table 3. Banding patterns of the amplified rDNA intergenic spacer (IGS) region after digestion with RsaI and EcoRI.

IGS (kb)	RsaI (bp)	EcoRI (bp)	Isolates
1.7	1200, 500	1200, 500	Vs3.1F, Vs3.3F
2	1200, 800	1100, 900	Bakt11, Bakt3, Bk2, V30, Vd2, Vd3, Vd4, Vdks5, Vdks6, Vdor, Vfa2, Vhmd, Vk1.1, Vk1.2, Vk1.3, Vk2/11, Vk3/11, Vk6/11, Vs1.1G, Vs1.2T, Vsb1.2, Vsh, Vz17, Zarmdine, Vsb1.4
	1500, 500	2000	Vmh3.2
2.1	1100, 850, 150	1100, 800, 200	Vs1.1ch, Vs1.2ch
	1200, 900	1100, 800, 200	Bakt7, Vdks3, Vms2, Vms3.2, Vsb1.3, Vcm2, Vk1.11, Vms3.3, Vsb.P, Vsb1.1, Vsbp7, Vsh 1.2

Fig. 4 Random amplified microsatellite (RAMS) pattern of Verticillium dahliae isolates using CGA primer. Lanes 1–15 are loaded with PCR products of VDKS5, Vd4, BAKT3, VS3.3F, VS1.2 T, VMS3.2, VMS2, VDKS6, VDKS3, VK1.2, Vd2, VK6.11, VFA2, BAKT11 and BAKT7, respectively. DNA size marker is indicated by M.

Fig. 5 Random amplified microsatellite (RAMS) pattern of Verticillium isolates using CCA primer. Lanes 1–21 are loaded with PCR products of Vsh1.2, VSBP7, BK2, Vmh3.2, VK1.11, Vk1.3, Vcm2, VS1.1ch, VSB1.1, Vsh, V30, Vd3, Vd4, Vz17, VSB1.4, VHmd, Vd2, VDOR, VS1.2ch, VS1.1 G and BAKT7, respectively. DNA size marker is indicated by M.

Table 4. RAMS banding patterns of the tested V. dahliae isolates using primers GT, CCA and CGA.

GT (bp)	CCA (bp)	CGA (bp)	Isolates
500	850	1400, 1200, 650, 550, 500, 350	Zarmdine
	1200, 500, 400	1200	Vsb1.4
		1100, 650, 500	Vk1.3
		1400, 1200, 650, 550, 500, 350	Vk1.11, Vmh3.2, Vsbp7
		2200, 1200, 1000, 650, 500	Vk1.1, Vk1.2, Vk2/11
		2200, 1400, 1200, 1000, 650, 500	Vfa2
	1200, 850, 500	1400, 1200, 650, 550, 500, 350	Bk2, Vcm2, Vsb.P, Vsb1.1
		1400, 650	Vd3
		2000, 1400, 1200, 850, 550, 350, 300	Vs1.2 T
		2200, 1200, 1000, 650, 500	Vdor, Vs1.2ch, Vsb1.2, Vsb1.3, Vz17
		2200, 1400, 1200, 1000, 650, 500	Bakt11, Bakt7, Vd4, Vms2, Vms3.2
		650, 550, 500, 350	Vms3.3, Vs1.1ch
	1500, 950, 550	1400, 1200, 650, 550, 500, 350	Vsh, Vsh1.2
	2000, 1200, 850	2200, 1200, 1000, 650, 500	Bakt3, V30, Vdks3, Vdks6, Vhmd
		2200, 1400, 1200, 1000, 650, 500	Vs1.1G
700	900	2000, 1400, 850, 750, 450, 400	Vdks5
700, 500	800	2200, 1400	Vs3.1F, Vs3.3F
2500, 2400, 500	1200, 500, 400	2200, 1200, 1000, 650, 500	Vd2, Vk3/11, Vk6/11

Fig. 6 (Colour online) Phylogenetic tree using matching coefficient based on RAMS bands of Verticillium fungal isolates with primer GT, CCA and CGA.

Nazar RN, Hu X, Schmidt J, Culham D, Robb J. 1991. Potential use of PCR-amplified ribosomal intergenic sequences in the detection and differentiation of Verticillium wilt pathogens. Physiol Mol Plant Pathol. 39:1–11. doi:10.1016/0885-5765(91)90027-F

 Web of Science ®Google Scholar

Appel D, Gordon TR. 1995. Intraspecific variation within populations of Fusarium oxysporum based on RFLP analysis of the intergenic spacer region of the rDNA. Exp Mycol. 19:120–128. doi:10.1006/emyc.1995.1014

 PubMedGoogle Scholar

Hantula J, Dusabenyagasani M, Hamelin RC. 1996. Random amplified microsatellites (RAMS) ? a novel method for characterizing genetic variation within fungi. Forest Pathology. 26:159–166. doi:10.1111/j.1439-0329.1996.tb00720.x

 Web of Science ®Google Scholar