Functional comparision between truncated MTT1 and truncated MTT2 from Tetrahyemna thermophila

Figures & data

Table 1. PCR primers used in this study.

Name	Sequence (5′—3 ′)
MTT1-F	GGATCCATGGATAAAGTTAATAGCTGTTGC
MTT1-R	CTCGAGTCATTTACAACATTGACAAGTCTGACA
MTT2-F	GGATCCATGGACACTCAAACTCAAAC
MTT2-R	CTCGAGTCAGCATTTGCATTCAGCAC
TM1-F	GGATCCATGGATAAAGTTAAT
TM1-R	CTCGAGTCATTTGCAGCACTTGCA
TM2-F	GGATCCATGGACACTCAAACT
TM2-R	CTCGAGTTAATTGCAGCCACAGCTTTCAGTA

GGATCC, BamH1 restriction enzyme cutting site; CTCGAG, XhoⅠ restriction enzyme cutting site .

Figure 1. Amino acid sequences of MTT1 and MTT2 from T. thermophila. The C₃X₆C_2, C₂X_6/8CXCX₂CXC₂X_1/2, and CXC represent different motifs. TM1 and TM2 indicate the truncated MTT1 and MTT2, respectively.

Figure 2. Expression and purification of GST, GST-MTT1, GST-MTT2, GST-TM1, and GST-TM2. (A) SDS-PAGE (12.5%) analysis of recombinant proteins. M: protein molecular weight markers; lane 1: total cell lysate of E. coli/pGEX-4T-1; lane 2: total cell lysate of E. coli/pGEX-MTT1; lane 3: total cell lysate of E. coli /pGEX-MTT2; lane 4: total cell lysate of E. coli/pGEX-TM1; lane 5: total cell lysate of E. coli /pGEX-TM2. (B) SDS-PAGE (12.5%) analysis of purified proteins. M: protein molecular weight markers; lane 1: GST; lane 2: GST-MTT1; lane 3: GST-MTT2; lane 4: GST-TM1; lane 5: GST-TM2. The proteins were purified using glutathione resins and Superdex 75 gel filtration chromatography.

Figure 3. Cd and Cu dose–response curve of recombinant MT E. coli. Recombinant E. coli/pGEX-MTT1, E. coli/pGEX-MTT2, E. coli/pGEX-TM1, and E. coli/pGEX-TM2 were exposed to CdCl₂ (A) and CuSO₄ (B). Cell concentration was measured at 600 nm using a spectrophotometer. All data are expressed as mean ± SD (n = 3).

Figure 4. Proliferation of recombinant MT in E. coli. Recombinant E. coli/pGEX-MTT1, E. coli/pGEX-MTT2, E. coli/pGEX-TM1, and E. coli/pGEX-TM2 were exposed to 287.1 μM CdCl₂ (A) and 429.5 μM CuSO₄ (B). E. coli/pGEX-4T-1 as a control, cell concentration was measured at 600 nm using a spectrophotometer. All data are expressed as mean ± SD (n = 3).

Figure 5. Accumulation of metal ion Cd²⁺ and Cu⁺ in MT transformed cells. Recombinant E. coli/pGEX-MTT1, E. coli/pGEX-MTT2, E. coli/pGEX-TM1, and E. coli/pGEX-TM2 were exposed to 287.1 μM CdCl₂ (A) and 429.5 μM CuSO₄ (B). E. coli/pGEX-4T-1 as a control. The metal ion was analyzed using an atomic absorption spectrometer. All data are expressed as mean ± SD (n = 3), ^*p < 0.05, ^**p < 0.001.

Figure 6. Reaction profiles of metal-binding complexs with DTNB. Each metal-bound protein sample at 1.5 nmol was dissolved in 300 μL of 10 mM PBS (pH 8.0), and reaction was started by adding 75 nmol of DTNB to solution. Absorbance at 412 nm at 25 °C was recorded for 60 min. A: Cd-bound protein sample; B: Cu-bound protein sample. Each value was the mean of two replicates.