Mixed fermentation of soybean meal by protease and probiotics and its effects on the growth performance and immune response in broilers

Figures & data

Table 1. Nutrient composition of the basal diet.

	CTRL	5% FSBM	10% FSBM
Ingredient %
Corn, yellow	51.6	51.8	52
Soybean meal (47% CP)	38.5	33.2	28
Soybean oil	5.9	6	6
CaCO3 (38%)	2	2	2
CaHPO4	1	1	1
Salt	0.4	0.4	0.4
Choline (50%)	0.02	0.02	0.02
Vitamin, premix^a	0.1	0.1	0.1
Mineral, premix^b	0.1	0.1	0.1
Methionine (99.5%)	0.3	0.3	0.3
Fermented soybean meal	0	5	10
Calculated composition
Crude protein %	23.05	23.05	23.10
Ca %	1.134	1.131	1.128
P %	0.579	0.575	0.572
Lysine %	1.224	1.222	1.224
Methionine + Cystine %	1	1	1.001
ME, kcal/kg	3217.81	3219.60	3215.68

^aSupplied per kilogram of diet: retinol, 6000 IU; cholecalciferol, 900 IU; tocopherol, 30 IU; menadione, 3 mg; riboflavin, 6 mg; pantothenic acid, 18 mg; niacin, 60 mg; and cobalamin, 30 μg.

^bSupplied per kilogram of diet: Cu, 20 mg; Zn, 100 mg; Fe, 140 mg; Mn, 4 mg; Se, 0.1 mg; and I, 0.2 mg.

Table 2. Primer sequences for quantitative reverse-transcription PCR.

Genes	Primer sequences (5′-3′)	Accession no.	Annealing temperature (°C)
IL-4	F: TGTGCCCACGCTGTGCTTACA	AJ621249.1	60.9
	R: CTTGTGGCAGTGCTGGCTCTCC
IL-10	F: AGCAGATCAAGGAGACGTTC	AJ621614	60.9
	R: ATCAGCAGGTACTCCTCGAT
β-actin	F: CCACCGCAAATGCTTCTAAAC	X00182	60.0
	R: GAAGGTGCAGCAGCAGTCTT

Figure 1. Effect of protease and probiotics on the soy protein content of FSBM. (A) Effects of different protease activity (10⁴, 10⁵, and 10⁶ CDU/kg), initial moisture (40%, 50%, and 100%), and fermentation durations (6, 12, and 24 h) on the soy protein content of FSBM. (B) Effects of different protease activity (10⁴, 10⁵, and 10⁶ CDU/kg), initial moisture (40%, 50%, and 100%), and fermentation durations (6, 12, and 24 h) on the soy protein content of FSBM produced by A. oryzae. (C) Effects of different protease activity (10⁴, 10⁵, and 10⁶ CDU/kg), initial moisture (40%, 50%, and 100%), and fermentation durations (6, 12, and 24 h) on the soy protein content of FSBM produced by B. subtilis. M represents the standard protein marker. Three experiments were conducted, and one representative result is displayed.

Figure 2. Effects of protease and probiotics on the β-conglycinin content of FSBM. (A) Effects of different protease activity (10⁴, 10⁵, and 10⁶ CDU/kg), initial moisture (40%, 50%, and 100%), and fermentation durations (6, 12, and 24 h) on the β-conglycinin contents of FSBM. (B) Effect of different protease activity (10⁴, 10⁵, and 10⁶ CDU/kg), initial moisture (40%, 50%, and 100%), and fermentation durations (6, 12, and 24 h) on the β-conglycinin content of FSBM produced by A. oryzae. (C) Effects of different protease activity (10⁴, 10^5, and 10⁶ CDU/kg), initial moisture (40%, 50%, and 100%), and fermentation durations (6, 12, and 24 h) on the β-conglycinin content of FSBM produced by B. subtilis. M represents the standard protein marker. Three experiments were conducted, and one representative result is displayed.

Figure 3. Effects of protease and probiotics on the subunits of β-conglycinin content of FSBM. The SBM was fermented with or without 10⁵ CDU/kg protease and probiotics (A. oryzae or B. subtilis) at an initial moisture content of 40% for 24 h. M represents the standard protein marker. Three experiments were conducted, and one representative result is displayed. The intensity of the β-conglycinin (α and β subunits) band was analyzed relative to the intensity of the untreated (SBM) group by using densitometer software. The numbers are the means of three independent experiments.

Figure 4. FPLC patterns of soy protein degradation by protease and probiotics. The SBM was fermented with 10⁵ CDU/kg protease and probiotics (A. oryzae or B. subtilis) at an initial moisture content of 40% for 24 h. (A) FPLC measurement of standard patterns of soy protein. (B) FPLC measurement of soy protein degradation in FSBM produced by protease and probiotics. The two black lines is used as an indicator of standard proteins (66 and 6.5 kDa) based on its retention time. Three experiments were conducted, and one representative result is displayed.

Figure 5. Effect of FSBM produced by B. subtilis on the immune-response-associated gene expression in the spleens and bursa of Fabricius of broilers. Effects of control (CTRL), 5% FSBM produced by B. subtilis (5% FSBM), and 10% FSBM produced by B. subtilis (10% FSBM) on IL-4 (A) and IL-10 (B) mRNA expression in the spleens of broilers at 21 d. Effects of control (CTRL), 5% FSBM produced by B. subtilis (5% FSBM), and 10% FSBM produced by B. subtilis (10% FSBM) on IL-4 (C) and IL-10 (D) mRNA expression in the bursa of Fabricius of broilers at 21 d. The values are expressed as mean ± standard deviation (n = 3). The means with different letter superscripts are significantly different (P < 0.05).

Figure 6. Effect of FSBM produced by B. subtilis on soybean-protein-specific immunoglobulin levels in broilers. (A) Effect of control (CTRL), 5% FSBM produced by B. subtilis (5% FSBM), and 10% FSBM produced by B. subtilis (10% FSBM) on the anti-soybean allergen IgG levels in broilers. (B) Effect of control (CTRL), 5% FSBM produced by B. subtilis (5% FSBM), and 10% FSBM produced by B. subtilis (10% FSBM) on the anti-soybean allergen IgA levels. The values are expressed as mean ± standard deviation (n = 3). The means with different letter superscripts are significantly different (P < 0.05).

Table 3. Effect of FSBM on the growth performance of broilers.

Group	CTRL		5% FSBM		10% FSBM		p value
	Mean	SD	Mean	SD	Mean	SD
Body weight (g)
1 d	38.94	0.19	38.89	0.10	38.78	0.10	0.3990
7 d	130.00	5.77	121.11	6.94	130.00	5.77	0.2076
14 d	326.67	20.82	288.89	33.72	324.44	18.36	0.2012
21 d	601.11	32.62	602.22	27.76	617.78	29.63	0.7594
Average daily gain (g/d)
1–7 d	13.01	0.81	11.75	1.00	13.03	0.82	0.2061
8–14 d	28.10	2.18	23.97	5.14	27.78	1.92	0.3517
15–21 d	41.00	2.18	42.17	7.16	42.70	2.79	0.9004
1–21 d	27.03	0.95	26.30	1.32	27.84	1.41	0.3770
Average daily feed intake (g/d)
1–7 d	16.83^a	1.45	14.29^b	0.10	15.87^a	0.27	0.0289
8–14 d	40.32	2.44	33.49	7.29	38.89	3.17	0.2619
15–21 d	59.52	8.30	55.71	5.61	60.00	1.26	0.6364
1–21 d	34.89^a	1.51	34.50^a	1.19	38.25^b	1.30	0.0262
FCR (daily feed intake/daily gain)
1–7 d	1.29	0.04	1.22	0.11	1.22	0.09	0.5443
8–14 d	1.44	0.06	1.40	0.02	1.40	0.04	0.4705
15–21 d	1.49	0.21	1.30	0.11	1.41	0.07	0.3302
1–21 d	1.41	0.06	1.31	0.03	1.34	0.06	0.1297

^a,bMeans within a row with no common superscript are significantly different (P < 0.05).