Effect of Ultra-Violet B on Release of Volatiles in Tea Leaf

Figures & data

Table 1 Primers for amplifying TBG and TBP genes. ^a

Gene	GenBank accession no.	Position	Sequence	Predicted size
TBG	AM2852295	Upper	AGAATGTCAAGGCTGCTC	235
		Lower	AAACTCTGTCCTCCTCACT
TBP	AB088027	Upper	ATTGCGGCTGGCGTGAAG	268
		Lower	TGCGAAATGAAGATACCAAAGTGT
^aTBG: ß-glucosidase; and TBP: ß-primeverosidase.

Table 2 Effect of UV-B on release of volatiles in tea cultivar Maoxie.^a

Compounds	0 h	Dark 2 h	UV-B 2 h	Dark 6 h	UV-B 6 h
1-Penten-3-ol		0.80c	1.28 a	1.05b	1.04b
2,2,4,4-tetramethyl-Pentane			2.46a		1.54b
7-Oxabicycloheptane					0.11a
2-Hexenal	14.66b	5.48d	19.17a	5.45d	9.43c
cis-Ocimene				1.86b	3.90a
cis-3-Hexenyl acetate	1.26b	0.78bc	1.65a		0.51d
4-Hexenyl butyrate			3.27a
cis-2-Pentenol	0.89cd	0.68d	2.15a	1.19b	0.97bc
1-Hexanol				1.47a	1.76a
3-methyl-4-pentenol		1.35a		1.27a
cis-3-Hexenol	1.88c		4.65a	2.66b
cis-4-Hexenol			2.56b		3.08a
trans-2-Hexenol				0.93b	1.25a
2- methylbutyl pentyl ester				0.51a	0.56a
α-Methyl-α-(4-methyl-3-pentenyl)-oxiranemethanol	3.01b	1.68d	5.06a	1.71d	2.35c
cis-3-Hexenyl butyrate			0.27b	0.52a	0.43ab
cis-linalool oxide	4.55b	2.32d	7.53a	2.12d	3.03c
trans-linalool oxide I				2.70a	1.14b
cis-3-Hexenyl isovalerate				0.51a	0.41a
2-Hexenyl butyrate					0.05a
3-methyl- 2-hexenyl butyrate					0.24a
2,4-Heptadienal					0.01a
2-Methyl-butyl aldoxime					0.27a
Benzaldehyde					0.28a
2-(2-Hydroxyethoxy) ethanol		0.42a	0.40a		0.03b
cis-Linalool	7.25b	3.28d	9.62a	3.85c	3.93c
n-Hexyl caproate				0.86b	1.14a
Benzene acetaldehyde				0.87b	1.11a
3-Hexenyl hexanoate			0.36b	0.99a
(E)-2-Hexenyl valerate					1.04a
2-Hexenyl hexanoate				0.43a	0.54a
2,6-Dimethyl-6-(4-methyl-3-pentenyl)-bicyclo[3.1.1]hept-2-ene				0.37b	0.79a
α-Farnesene			0.27b	5.57a	6.49a
Methyl salicylate	1.93b	0.93d	3.45a	1.25c	1.33c
trans-Linalool	2.19b	1.19d	4.53a	1.32cd	1.49c
Geraniol			0.21b	1.52a
Phenmethylol	0.43b		0.67a	0.60a	0.61a
β-Phenylethanol	0.55c		0.95b	0.88b	1.35a
α-Benzyl cyanide				1.51b	1.74a
α-Ionone					0.04a
Jasmone			0.28a		0.26a
Nerolidol	0.66d	0.64d	2.74c	3.01b	3.96a
Benzoate-3-Hexen-1-ol			0.27a		0.28a
Docosane					0.06a
2,4-bis(1,1-dimethylethyl)-phenol		0.19c	0.46a	0.35b	0.32b
Tetracosane			0.44a		0.34b
Indolizine		0.63c	3.01b	3.64b	4.97a
Eicosane	1.84a	0.84b	1.81a
Diisobutyl phthalate		0.37c	0.91a	0.59bc	0.74b
Phytol			0.54a		0.06b
1-Docosene			0.64a
Heptacosane		0.49a
Octadecane			1.28a
Tetradecanoic acid			0.63a		0.17b
Tetracosane				1.49a
n-Hexadecanoic acid	1.03c	0.85d	2.98a	1.38bc	1.57b
Total	42.13	22.92	86.5	54.43	66.71
^aThe measuring unit was presented as the ratio of peak area of detected volatile to that of internal standard (ethyl caprate, 0.2 μg μL^−1); data with different alphabetic letter in a same row were significantly different at ρ = 0.05. (n = 2).

Table 3 Effect of UV-B on release of volatiles in tea cultivar Anhui-9.^a

Volatile compounds	0 h	Dark2 h	UV-B2 h	Dark6 h	UV-B6 h
Furfural	0.08b	0	0.33a	0	0
Benzaldehyde	0.18b	0.13c	0.32a	0.10c	0.13c
Benzeneacetaldehyde	0.14b	0.06c	0.80a	0.04c	0.04c
2,4-Heptadienal	0.84b	0.34c	1.27a	0.34c	0.14d
2,7-Dimethyl-2,6-octadienol	0.06b	0.04b	0.15a	0.06b	0.09b
1-Pentanol	0.10a	0.03b	0.15a	0	0
2-Penten-1-ol	0.05b	0.11a	0.12a	0	0.02b
β-Phenylethanol	0.03b	0.06b	0.20a	0.04b	0.04b
β-Benzylethanol	0.03b	0.04b	0.24a	0.02b	0.03b
α-Cadinol	0.05c	0.14b	0.24a	0.15b	0.09bc
Cedrol	0.07c	0.15b	0.20a	0.16b	0.11bc
cis-Linaloloxide	0.12c	0.08d	0.20a	0.04d	0.16bc
3,7-dimethyl-1,6-octadien-3-ol	0.18bc	0.16c	0.43a	0.15c	0.18bc
α-Terpineol	0.29b	0.17c	0.41a	0.17c	0.13c
Phytol	0.04d	0.14b	0.94a	0.14b	0.10c
Methyl jasmonate	0	0.05b	0.19a	0.07b	0.03b
Dioctyl phthalate	0.03c	0.04c	0.30a	0.06bc	0.08b
Diisobutyl phthalate	0.11d	0.45c	0.80a	0.56b	0.40c
Methyl linolenate	0	0.08c	0.31a	0.14bc	0.09c
N-Ethyl-(2-methyl-2-propenyl)-amine	0.02c	0.07b	0.27a	0.07b	0.04c
Dibutyl phthalate	0.07d	0.15c	0.48a	0.22b	0.15c
9,12-Octadecadienoic acid-methyl ester	0	0.04b	0.12a	0.06b	0.03b
Acetophenone	0.07b	0.05b	0.24a	0.07b	0.05b
α-Ionone	0.09c	0.15b	0.34a	0.12b	0.14b
2,3-Octanedione	0.08b	0.05c	0.16a	0.03c	0.03c
β-ionone	0.40b	0.49b	0.89a	0.43b	0.38b
α--Farnesene	0.06b	0.05b	0.12a	0.05b	0.04b
1,3,5,8-Undecatetraene	0.09b	0.04c	0.23a	0.03c	0.03c
Epoxylinalool	0.13b	0.07c	0.42a	0.07c	0.07c
5-Pentyl-1,3-benzenediol	0.17bc	0.23b	0.62a	0.24b	0.15c
cis-Linalool	1.14b	0.78c	1.71a	0.70c	0.86bc
Nerolidol	0.60c	1.16b	1.37a	1.36a	1.24b
Dehydrolinalool	1.02b	0.61c	1.89a	0.35d	0.53c
Phenacetonitrile	0.03b	0.05b	0.10a	0.04b	0.06c
1-Ethyl-2-methyl-benzene	0.19bc	0.16b	0.41a	0.10c	0
4-Amino-2,5-dimethyl-phenol	0.03b	0.04b	0.11a	0.01b	0.02b
2,4-bis(1,1-dimethylethyl)-phenol	0.07b	0.08b	0.17a	0.11ab	0.09b
Total	6.66	6.54	17.25	6.30	5.77
^aThe measuring unit was presented as the ratio of peak area of detected volatile to that of internal standard (ethyl caprate, 0.2 μg μL^−1); data with different alphabetic letter in a same row were significantly different at ρ = 0.05 (n = 2).

Figure 1 Effect of UV-B on expression of TBG and TBP genes in tea shoots. A: Cultivar Maoxie; B: cultivar Anhui-9; TBG: β-glucosidase gene; and TBP: β-primeverosidase gene. 1: Freshly picked tea shoot (0 h); 2: Under dark condition for 2 h; 3: UV-B irradiation for 2 h; 4: Under dark condition for 6 h; 5: UV-B irradiation for 6 h.