Detection of aflD gene in contaminated pistachio with Aspergillus flavus by DNA based electrochemical biosensor

Figures & data

Scheme 1. The glassy carbon electrode was coated with AuNPs (AuNP—GCE). A specific ssDNA probe of aflD gene was immobilized on AuNP–GCE. In the absence of the target DNA, the flexible ssDNA probe supports efficient contact between the [Fe(CN)₆]^3−/4− reducer and AuNP—GCE, there is a low electron transfer resistance (R_et) of the electrochemical DNA sensor. After the hybridization, a rigid probe-target duplex is formed which contact between the [Fe(CN)₆]^3−/4− reducer and AuNP—GCE was prevented. This leads to an increasing in the Ret of the electrochemical DNA sensor.

Table 1. DNA probe, target, and primers.

Name	Sequence (5ꞌ→3ꞌ)
Probe DNA	CTACCAGGGGAGTTGAGATCC
Target DNA	GGATCTCAACTCCCCTGGTAG
Primer F	GGGGCACTTCGTTATCCACA
Primer R	ATAT GACT GCGC TTCG TCGT

Figure 1. Agarose gel electrophoresis of PCR product. ((af): PCR product of A. flavus. (bf): PCR product of contaminated pistachio. (cf): control experiment without any genes).

Figure 2. a. Cyclic voltammograms of bare electrode and AuNP electrodeposited electrode (potential scanning: −0.2–0.6 V, Scan rate: 50 mV s^−1, in 10 mM [Fe(CN)₆]^3−/4−). b. Cyclic voltammogram recorded at AuNP–GCE (potential scanning: −0.2–1.6 V, Scan rate: 50 mV s⁻¹, N = 10, in 0.1 M NaNO₃ aqueous solution with 0.25 mM HAuCl₄ · 3H₂O and 0.01 M H₂SO4).

Figure 3. SEM images of AuNP–GCE provided by electrodeposition from a 0.1 M NaNO₃ aqua solution with 0.25 mM HAuCl₄·3H₂O and 0.01 M H₂SO4.

Figure 4. EIS of different modified electrode. (EIS was performed in a base solution of 10 mM [Fe(CN)₆]^3−/4− with 0.1 M KCl and 0.1 M PBS buffer pH 7.4. EIS was registered in the frequency ranging from 0.1 to 10⁵ Hz at a constant potential EIS of 150 mV with an alternating voltage of 10 mV).

Figure 5. EIS of different incubation time of probe. (EIS was performed in a base solution of 10 mM [Fe(CN)₆]^3−/4− with 0.1 M KCl and 0.1 M PBS buffer pH 7.4. EIS was registered in the frequency ranging from 0.1 to 10⁵ Hz at a constant potential EIS of 150 mV with an alternating voltage of 10 mV).

Figure 6. EIS of different incubation time of hybridization. (EIS was performed in a base solution of 10 mM [Fe(CN)₆]^3−/4− with 0.1 M KCl and 0.1 M PBS buffer pH 7.4. EIS was registered in the frequency ranging from 0.1 to 10⁵ Hz at a constant potential EIS of 150 mV with an alternating voltage of 10 mV).

Figure 7. EIS of hybridization process at a different concentration of DNA target. (a) probe; (b) 0.001 µM; (c) 0.005 µM; (d) 0.01 µM; (e) 0.05 µM; (f) 0.1 µM; (g) 1.0 µM; (h) 10 µM. (EIS was performed in a base solution of 10 mM [Fe(CN)₆]^3−/4− with 0.1 M KCl and 0.1 M PBS buffer pH 7.4. EIS was registered in the frequency ranging from 0.1 to 10⁵ Hz at a constant potential EIS of 150 mV with an alternating voltage of 10 mV).

Figure 8. EIS of PCR product. (af): PCR product of Aspergillus flavus. (bf): PCR product of contaminated pistachio. (cf): control experiment, without any genes. (R): random 76-mer sequence. (EIS was performed in a base solution of 10 mM [Fe(CN)₆]^3−/4− with 0.1 M KCl and 0.1 M PBS buffer pH 7.4. EIS was registered in the frequency ranging from 0.1 to 10⁵ Hz at a constant potential EIS of 150 mV with an alternating voltage of 10 mV).