Health functional properties of unhulled red djulis (Chenopodium formosanum) in anti-aging

Figures & data

Table 1. Real-time quantitative PCR primers used in this study

Gene Name	Primer Name	Primer Sequence	Gene Function
TGM1	TGM1-F	5′- GATCGCATCACCCTTGAGTTAC −3′	Epidermal barrier structural genes
	TGM1-R	5′- GCAGGTTCAGATTCTGCCC −3′
KRT10	KRT10-F	5′- TCCTACTTGGACAAAGTTCGGG −3′	Epidermal barrier structural genes
	KRT10-R	5′- CCCCTGATGTGAGTTGCCA −3′
KRT14	KRT14-F	5′- TTCTGAACGAGATGCGTGAC −3′	Epidermal barrier structural genes
	KRT14-R	5′- GCAGCTCAATCTCCAGGTTC −3′
SOD1	SOD1-F	5′- GGTGGGCCAAAGGATGAAGAG −3′	Antioxidative gene
	SOD1-R	5′- CCACAAGCCAAACGACTTCC −3′
COL1A2	COL1A1-F	ATCAACCGGAGGAATTTCCGT	Provides instructions for making part type I collagen
	COL1A1-R	CACCAGGACGACCAGGTTTTC
MMP9	MMP9-F	GGGACGCAGACATCGTCATC	Enzymes engaged in the degradation and remodeling of extracellular matrix (ECM)
	MMP9-R	TCGTCATCGTCGAAATGGGC

Figure 1. The effect of unhulled red djulis on cell cytotoxicity and wound healing. (A) CCD-966SK cells were treated with unhulled djulis extract (0.125%, 0.25%, 0.5%, 1%). Then, cytotoxicity was assessed through MTT assay. (B) Scrape with a sterile 1-ml pipette tip and then CCD-966SK cells were cultured with unhulled djulis extract (0.125%, 0.25%, 0.5%, 1%), and then using Image J software to analysis. (n = 3; mean ± SD, using a paired Student’s t-test, *p < .05 compared with control group)

Figure 2. Unhulled red djulis extracts regulated TGM1, KRT1, KRT10, SOD2, COL1A2 and MMP9 expression. CCD-966SK cells were treated with unhulled djulis extract (0.5%), and then used qPCR analysis. (A) Skin related genes: TGM1, KRT1, KRT10, antioxidant-related genes: SOD2. (B) Collagen-related genes: COL1A2 and MMP9. (n = 3; mean ± SD, using a paired Student’s t-test, *p < .05 compared with control group)

TGM1: transglutaminase 1. KRT1: Keratin 1. KRT10: Keratin 10. SOD2: superoxide dismutase 2. COL1A2: collagen type I alpha 2 chain. MMP9: matrix metallopeptidase 9.

Figure 3. The effect of unhulled red djulis extracts on formation of AGEs and melanin. CCD-966SK cells were treated with unhulled djulis extract (0.5%), and then (A) analyzed the AGEs through advanced glycation end-products assay. (B) Analyzed the melanin through tyrosinase activity inhibition assay. (n = 3; mean ± SD, using a paired Student’s t-test, *p < .05 compared with control group)

Figure 4. Effects of unhulled red djulis extracts on collagen content. CCD-966SK cells were treated with unhulled djulis extract (0.5%), and then analyzed the collagen by immunofluorescence staining. Green color: collagen. Blue color: Nucleus. (n = 3; mean ± SD, using a paired Student’s t-test, *p < .05 compared with control group)

Table 2. Antioxidant capacity of djulis extract

	Extraction Temperature (°C)	Total flavones content (μg/mL)	Total phenolic content (μg/mL)
Unhulled red djulis	25	418 ± 14	326 ± 26
	50	418 ± 4	332 ± 18
	70	421 ± 8	318 ± 20
Hulled red djulis	25	105 ± 7	110 ± 2
	50	116 ± 9	90 ± 18
	70	87 ± 9	73 ± 11

Figure 5. Effective components of unhulled red djulis extracts increased collagen content. (A) Profiles of unhulled red djulis extracts and compound structures. (B) CCD-966SK cells treated with 0.2 mg/mL of compounds 1–6, and then analyzed by collagen secretion assay. (n = 3; mean ± SD, using a paired Student’s t-test, *p < .05 compared with control group)