Detection of chicken adulteration in beef via ladder-shape melting temperature isothermal amplification (LMTIA) assay

Figures & data

Figure 1. Ladder-type melting temperature curve of the target sequence.

Figure 2. Results of the target sequence alignment in GenBank.

Table 1. LMTIA primers targeting the prolactin receptor gene of Gallus gallus.

Primer	Sequence (5′-3′)
L (Left Primer)	CCCGATGATCCGGTTTTTCCTCCCGTGGCTTCAAAG
R (Right Primer)	TTTAATCGCATTGCCTTTTTAATTTCCATCAAAGTTCTGCAGC

Figure 3. Temperature optimization of the LMTIA reaction 52 °C (A); 54 °C (B); 56 °C (C); 58 °C (D). The data show two parallel positive controls (100 ng genomic DNA of Gallus gallus) and two parallel negative controls (ddH₂O) at each temperature.

Figure 4. Specificity determination of the LMTIA assay.

Figure 5. Sensitivity determination of the developed LMTIA assay using the genomic DNA of Gallus gallus ranging from 10 ng to 10 fg.

Figure 6. Detection limit determination of the developed LMTIA assay using artificial samples.

Data availability statement

The data that support this study are available from the corresponding author upon reasonable request.