Analysis of cytokinin content and associated genes at different developmental stages in pak choi (Brassica rapa ssp. chinensis Makino)

Figures & data

Table 1. Real-time quantitative PCR primers.

Primer name	Primer sequence
ACTIN	GTTGCTATCCAGGCTGTTCT
	AGCGTGAGGAAGAGCATAAC
Bra009768	AGTTACAGAGTCGCTGCT
	TATTAACCGAGTCCTGTGTTG
Bra033944	AGAACTAACCAATCATCCGT
	CTACAACAGCATTGACACTC
Bra029407	CGTCCTGTAATAGGGAATGG
	TGGCTTCTTTAGTTGAGTCC
Bra022176	GCCAAGGGTAGGAAACTCAC
	ACGCCACTTCTTCTTGGTTG
Bra004744	GTGAGAACTTTGGTTGCGGG
	AGTAGCCACCGAGTTACGGA
Bra022448	GATCAGCCTAGGGAAACACA
	TTATCAGACTCACCTCTCCAG

Figure 1. Comparison of cytokinin content in the shoot apexes of pak choi at different developmental stages. DAV0, 0 days after transplanting; DAV10, 10 days after transplanting; S0, Stage immediately prior to flower bud differentiation; S1, flower bud differentiation stage 1.

Table 2. Illumina DNA sequencing reads from nine libraries and mapping results.

Sample	Total reads	Clean reads	Mapped reads	Unique mapped reads
DAV10-1	53,756,300	26,878,150	46,796,446 (87.05%)	45,673,996 (84.96%)
DAV10-2	46,233,658	23,116,829	40,071,945 (86.67%)	39,088,760 (84.55%)
DAV10-3	41,857,180	20,928,590	36,305,125 (86.74%)	35,431,203 (84.65%)
S0–1	46,995,194	23,497,597	41,171,901 (87.61%)	40,153,268 (85.44%)
S0–2	45,981,760	22,990,880	39,519,741 (85.95%)	38,479,871 (83.69%)
S0–3	39,083,622	19,541,811	33,511,771 (85.74%)	32,642,398 (83.52%)
S1–1	40,207,374	20,103,687	34,752,592 (86.43%)	33,797,693 (84.06%)
S1–2	56,949,456	28,474,728	49,069,645 (86.16%)	47,472,852 (83.36%)
S1–3	51,518,858	25,759,429	44,351,302 (86.09%)	43,125,438 (83.71%)

Total reads, number of all reads; clean reads, number of reads after filtering joined sequences, contaminated sequences and low-quality sequences; mapped reads, the number of reads mapped to the reference genome and the percentage of clean reads. Unique mapped reads, number of reads mapped to unique locations in the reference genome and the percentage of clean reads mapped. DAV10, 10 days after transplanting; S0, stage immediately prior to flower bud differentiation; S1, flower bud differentiation stage 1; 1, 2 and 3 represent three biological replicates.

Figure 2. Three-dimensional PCA of shoot apexes samples at different developmental periods.

Figure 3. Comparison of RNA sequencing and RT-qPCR results.

Figure 4. The trans-zeatin metabolic pathway.

Table 3. Genes and enzymes related to cytokinin metabolism.

				FPKM			Expression pattern
Deoxy-xylulose pathway	Enzyme ID	Enzyme	Coding gene in pak choi	DAV10	S0	S1	DAV10 vs. S0	S0 vs. S1
Biosynthetic	2.2.1.112	IPT1	Bra004037	0.02 ± 0.01	0.04 ± 0.01	0.02 ± 0.01	Up	Down
		IPT1	Bra033933	0.31 ± 0.07	0.31 ± 0.02	0.50 ± 0.02	–	Up
	2.5.1.27	IPT1	Bra004037	0.02 ± 0.01	0.04 ± 0.01	0.02 ± 0.01	Up	Down
		IPT1	Bra033933	0.31 ± 0.07	0.31 ± 0.02	0.50 ± 0.02	–	Up
		IPT3	Bra007728	2.85 ± 0.65	2.75 ± 0.69	1.64 ± 0.48	Down	Down
		IPT3	Bra040431	0.49 ± 0.07	0.41 ± 0.09	0.58 ± 0.08	Down	Up
		IPT5	Bra023701	0.00	0.25 ± 0.06	0.13 ± 0.08	Up	Down
		IPT5	Bra002204	0.06 ± 0.02	1.04 ± 0.04	0.46 ± 0.06	Up	Down
		IPT7	Bra014968	0.00	0.21 ± 0.07	0.04 ± 0.01	Up	Down
		IPT7	Bra028326	0.00	0.03 ± 0.01	0.00	Up	Down
		IPT7	Bra037537	0.00	0.00	0.02 ± 0.01	–	Up
		IPT8	Bra001737	0.00	0.00	0.00	–	–
	CYP735As	CYP735A1	Bra028182	0.05 ± 0.01	0.27 ± 0.04	0.18 ± 0.08	Up	Down
		CYP735A2	Bra034021	0.28 ± 0.09	0.10 ± 0.01	0.08 ± 0.02	Down	Down
		CYP735A2	Bra034022	0.09 ± 0.02	0.15 ± 0.05	0.09 ± 0.02	Up	Down
Catabolism	UGT76Cs	UGT76C1	Bra009143	92.87 ± 9.64	35.45 ± 5.89	22.67 ± 2.83	Down	Down
		UGT76C2	Bra009142	1.25 ± 0.25	2.1 ± 0.62	0.91 ± 0.15	Up	Down
		UGT76C4	Bra005869	0.13 ± 0.01	0.03 ± 0.01	0.00	Down	Down

FPKM: reads per kb per million reads.

Table 4. Analysis of DEGs related to cytokinin metabolism in different developmental stages of pak choi.

			FPKM			log2FC
Gene name	Coding enzyme	GO function	DAV10	S0	S1	DAV10 vs. S0	S0 vs. S1
Bra023701	IPT5	Cytokinin biosynthesis process	0.00	0.25 ± 0.06	0.13 ± 0.08	4.64	–
Bra002204	IPT5	Cytokinin biosynthesis process	0.06 ± 0.02	1.04 ± 0.04	0.46 ± 0.06	4.12	–1.18
Bra014968	IPT7	Cytokinin biosynthesis process	0.00	0.21 ± 0.07	0.04 ± 0.01	4.39	–2.39
Bra028182	CYP735A1	Trans-zeatin biosynthesis	0.05 ± 0.01	0.27 ± 0.04	0.18 ± 0.08	2.43	–
Bra034021	CYP735A2	Trans-zeatin biosynthesis	0.28 ± 0.09	0.10 ± 0.01	0.08 ± 0.02	–1.49	–
Bra009143	UGT76C1	Cytokinin 7-β-glucosyltransferase activity, Cytokinin 9-β-glucosyltransferase activity	92.87 ± 9.64	35.45 ± 5.89	22.67 ± 2.83	–1.39	–
Bra009142	UGT76C2	Cytokinin 7-β-glucosyltransferase activity, Cytokinin 9-β-glucosyltransferase activity	1 25 ± 0.25	2.1 ± 0.62	0. 91 ± 0. 15	–	–1.21
Bra005869	UGT76C4	Cytokinin 7-β-glucosyltransferase activity, Cytokinin 9-β-glucosyltransferase activity	0.13 ± 0.01	0.03 ± 0.01	0.00	–2.12	–

–, no significant difference.

Figure 5. Differentially expressed genes closely related to cytokinin metabolism at different developmental stages of pak choi. DAV10, 10 days after transplanting; S0, stage immediately prior to flower bud differentiation; S1, flower bud differentiation stage 1; green, blue and red indicate gene expression from low to high. Genes in purple font are closely related to cytokinin content.

Data availability

The datasets presented in this study can be found in online repositories. The names of the repository/repositories and accession number(s) can be found below: https://www.ncbi.nlm.nih.gov/sra/PRJNA821155