M6A modification regulates tumor suppressor DIRAS1 expression in cervical cancer cells

Figures & data

Table 1. shRnas targeting sequences.

Names	Targeting sequences
shDIRAS1	CTACAAGCTCATCGTGCAGAT
shMETTL3	GCCTTAACATTGCCCACTGAT
shMETTL14	CCATGTACTTACAAGCCGATA
shALKBH5	GAAAGGCTGTTGGCATCAATA
shFTO	TCACGAATTGCCCGAACATTA

Figure 1. Knockdown of DIRAS1 significantly promotes proliferation, growth and motility of C33A and SiHa cells.

The protein expression of DIRAS1 (a), the absorbance values at 450 nm of cells (b), the formed clones (c), the cells completed migration or invasion (d) in knockdown (KD) group of C33A and SiHa cells transfected with targeted shRNA plasmid. ***p < .001.

Figure 2. DIRAS1 overexpression significantly inhibits the proliferation, growth and motility of C33A and SiHa cells.

The protein expression of DIRAS1 (a), the absorbance values at 450 nm of cells (b), the formed clones (c), the cells completed migration or invasion (d) in overexpression (OV) group of C33A and SiHa cells transfected with pcDNA3.1 -expressing recombinant plasmid. *p < .05, **p < .01, ***p < .001.

Figure 3. Altered expression pattern of DIRAS1 in cervical cancer tissues.

(A). DIRAS1 mRNA levels in normal cervical tissues, cervical squamous cell carcinoma and endocervical adenocarcinoma (CESC) tissues, and CESC metastatic tissues. RNA-Seq data from the TNM database. (B) DIRAS1 mRNA levels in normal cervical tissues and CESC tissues. Data from the GEPIA database. (C) IHC analysis of DIRAS1 on cervical cancer tissues and para-cancerous tissues. *p < .05.

Table 2. DIRAS1 expression in cervical cancer tissues compared with para-carcinoma tissues.

Group	n	DIRAS1 expression
		Low (n%)	High (n%)	P
cervical cancer	48	32 (66.7)	16 (33.3)	0.004**
para-carcinoma	48	17 (35.4)	31 (64.6)

Table 3. DIRAS1 expression associated with the clinicopathological parameters in CCA.

clinicopathological parameters	n	DIRAS1 Low (n%)	DIRAS1 High (n%)	P
Age (years)
≤55	23	17 (73.9)	6 (26.1)	.529
>55	23	14 (60.9)	9 (39.1)
Tumor diameter (cm) ≤2 >2	18 28	13 (72.2) 18 (64.3)	5 (27.8) 10 (35.7)	.812
Pathological grading II III	23 23	11 (47.8) 20 (87.0)	12 (52.2) 3 (13.0)	.012*

Figure 4. The mechanisms of epigenetic regulation to regulate DIRAS1.

The specific DNA methylation inhibitor 5-aza-dC (a and b), histone deacetylase inhibitor SAHA (c and d) and FTO inhibitor FB23-2 (e and f) treated the, and the mRNA and protein levels of DIRAS1 in cells. *p < .05, **p < .01, ***p < .001.

Figure 5. M6A modification promotes DIRAS1 translation.

The DIRAS1 protein levels in C33A and SiHa cells in which the expression of METTL3, METTL14, METTL3/METTL14 (a), FTO and ALKBH5 (b) were significantly downregulated using specific shRNA plasmid transfection, respectively. ***p < .001.

Data availability statement

The datasets generated during and/or analyzed during the current study are not publicly available, but are available from the corresponding author on reasonable request.