Aberrant regulation of CXCR4 in cancer via deviant microRNA-targeted interactions

Figures & data

Table 1. Deregulated tumour suppressor (n = 24) or oncogenic (n = 3) miRNAs identified as CXCR4 targets in human cancers with corresponding downstream target genes and pathways.

MicroRNA	Type of cancer	MicroRNA function	3'UTR of CXCR4 & miRNA binding	Binding targets and downstream genes/pathways	Prognostic marker	Patient survival	Reference
miR‐126	Colorectal cancer	Tumour suppressor	5’-GGTAGGA-3’ 3’-CCAUGCU-5’	CXCR4, AKT & ERK1/2, IRS-1, and RhoA signaling	Yes	Available	[82–85]
miR-622	Colorectal cancer	Tumour suppressor	5’-AGACUG-3’ 3’-UCUGAC-5’	CXCR4-VEGFA signaling	No	Not done	[88]
miR-133b	Colorectal cancer	Tumour suppressor	5’-GACCAA-3’ 3’-CUGGUU-5’	CXCR4, VEGF, and MMP-9	Yes	Not done	[86]
miR-193a-5p	Colorectal cancer	Tumour suppressor	Not found	EMT, Vimentin CXCR4	No	Not done	[87]
miR-302a	Breast Cancer	Tumour suppressor	5’-GCACUUA-3’ 3’-CGUGAAU-5’	CXCR4, AKT & RAD 52	No	Not done	[90]
miR-494	Breast cancer	Tumour suppressor	5'AGTTTTCAGGAGTGGGTT-3’ 3'UCCAAAGGGCACAUACAA-5’	CXCR4, Wnt/β catenin signaling, LEF1, CD44, cyclin D1	No	Not done	[92]
miR-146a	Breast cancer	Tumour suppressor	5'TGGTTTTTCAGTTTTC-3’ 3'ACCUUAAGUCAAGAG-5’	CXCR4, TRAF6, EGFR, IRAK1, MTA2 IL-6, IL-8, VEGF, NF-κB pathway	No	Not done	[89]
miR-381	Breast Cancer	Tumour suppressor	5’-CUUGUAU-3’ 3’-GAACAUA-5’	CXCR4, EMT, MMP-2, MMP-9, Vimentin, N-cadherin, and E-cadherin	No	Not done	[91]
miR-9	Acute myeloid leukemia	Tumour suppressor	5’-ACCAAAG-3’ 3’-UGGUUUC-5’	CXCR4, Cyclin D1, MMP-2, MMP-9, Bcl-2 & Bax	No	Available	[96]
miR-146a	Acute myeloid leukemia	Tumour suppressor	5'TGGTTTTTCAGTTTTC-3’ 3'ACCUUAAGUCAAGAG-5’	CXCR4, HIF-1α or −2α, CXCR4	No	Not done	[93–95]
miR-622	Acute myeloid leukemia	Tumour suppressor	5'GUACUGGUCUCAGCAGAUUG3’ 3'CGAGGUUGGAGUCGUCUGAC5’ *	CXCR4 and uPAR	No	Not done	[93]
miR-335	Acute myeloid leukemia	Tumour suppressor	Not found	CXCR4 and uPAR	No	Not done	[93]
miR-206	Gastric Cancer	Tumour suppressor	5’-ACAUUCCA-3’ 3’-UGUAAGGU-5’	CXCR4, MAP-, PI3K-AKT, mTOR, TGF-β, HIF-1, and Hippo pathway	No	Available	[121]
miR-139	Gastric cancer	Tumour suppressor	5'CUUAAGACGUGAU UUUGCUGUAGA-3’ 3'GACCUCUGUGC–ACGUGACAUCU-5’	HER2 signaling, CD44, CXCR4	Yes	Not done	[106]
miR-155-5p	Gastric cancer	Tumour suppressor	Not found	SMAD1, STAT1, CAB39, CXCR4, CA9	No	Not Done	[98]
miR-122	Hepatocellular carcinoma	Tumour suppressor	Not found	NUSAP1, CXCR4, CXCR2, ITGAV	No	Not Done	[99]
miR-622	Hepatocellular carcinoma	Tumour suppressor	5'TTCAGATATAAAAGACTG-3’ 3'AGGUUGGAGUCGUCUGAC-5’	CXCR4, SDF1 (CXCL12) EZH2	Yes	Available	[108]
miR-494-3p	Prostate cancer	Tumour suppressor	5’-UGUUUC-3’ 3’-ACAAAG-5’	CXCR4, SDF-1 (CXCL12)	Yes	Not done	[110]
miR-338-3p	Prostate cancer	Tumour suppressor	5’-AUGCUGG-3’ 3’-UACGACC-5’ **	CXCR4, CXCR7, CXCL1	Yes	Available	[109]
miR-1	Thyroid carcinoma	Tumour suppressor	5’-ACAUUCCA-3’ 3’-UGUAAGGU-5’	CXCR4, Cyclin D2, SDF-1α	No	Not done	[100]
miR-126	Thyroid Cancer	Tumour suppressor	5’-GGTAGGA-3’ 3’-CCAUGCU-5’	CXCR4	No	Not done	[101]
miR-9	Oral squamous cell carcinoma	Tumour suppressor	5’-ACCAAAG-3’ 3’-UGGUUUC-5’	CXCR4, Wnt/β-catenin signaling, Bcl-2, c-myc, c-Jun, and p-c-Jun	No	Not done	[119]
miR-143	Oral squamous cell cancer	Tumour suppressor	Not found	CXCR4, K-Ras, MMP9, C-Myc, ADAMTS	Yes	Not done	[111]
miR-494	Pancreatic cancer	Tumour suppressor	5’-UGUUUC-3’ 3’-ACAAAG-5’ ** (miR494-3p)	ZEB1, CXCR4, HIF1A, SDC1, TWIST1	Yes	Available	[112]
miR-494-3p	Synovial sarcoma	Tumour suppressor	5’-UGUUUC-3’ 3’-ACAAAG-5’ **	CXCL12, CXCR4	No	Not done	[116]
miR-613	Osteosarcoma	Tumour suppressor	5’-ACAUUCC-3’ 3’-UGUAAGG-5’	SDF-1, CXCR4	No	Available	[102]
miR-301a	Esophageal cancer	Tumour suppressor	Not found	CXCR4, Wnt/β-catenin and NF-κB signaling	No	Not done	[122]
miR-302b	Esophageal cancer	Tumour suppressor	5’-GCACUU-3’ 3’-CGUGAA-5’ **	ERBB4, IRF2 & CXCR4	No	Not done	[103]
miR-139	T-cell acute lymphoblastic leukemia	Tumour suppressor	5’-CUGUAGA-3’ 3’-GACAUCU-5’	CXCR4	Yes	Available	[97]
miR-139	Laryngeal squamous cell carcinoma	Tumour suppressor	5’-CUGUAGA-3’ 3’-GACAUCU-5’	CXCR4	Yes	Not done	[107]
miR-9	Head and Neck Squamous cell carcinoma	Tumour suppressor	5’-CUUUGGU-3’ 3’-GAAACCA-5’	CXCR4, CXCL12	Yes	Not done	[113]
miR-9	Nasopharyngeal carcinoma	Tumour suppressor	5’-ACCAAAG-3’ 3’-UGGUUUC-5’	CXCR4, CXCL12, p38 MAPK pathway	Yes	Not done	[114]
miR140	Nasopharyngeal carcinoma	Tumour suppressor	5’-CCUGUGG-3’ 3’-GGACACC-5’	CXCR4, Caspase-3, Bcl-2, and PARP	No	Not done	[104]
miR-663	Glioblastoma	Tumour suppressor	5'TGGATCCCTGCC-3’ 3'GCCGCGGGGCGG5’	CXCR4, PIK3CD	Yes	Available	[115]
miR-1246	Lung cancer	Tumour suppressor	Not found	CXCR4, JAK/STAT/PI3K/AKT signaling pathways, E-cadherin, N-cadherin, Vimentin, ZEB1, and Snail	No	Not done	[105]
miR-125b	Colorectal cancer	OncomiR or Tumour promoter	Not found	CXCR4, Wnt/β-catenin signaling, APC gene, ZEB1, Snail, Vimentin, and E-cadherin	No	Not done	[129]
miR-301a	Osteosarcoma	OncomiR or Tumour promoter	Not found	CXCR4, Wnt/β-catenin and NF-kB signaling, Bcl-2, Bax, caspase-3, and caspase-9	No	Not done	[131]
miR-199a-5p	Melanoma	OncomiR or Tumour promoter	Not found	CXCR4, Myc, Tnfsf10, cd44, Cxcr4, Mmp3, Rb1, Tcf20, Hprt1, Actb1, Rpsa, Etv4, Fxyd5 and Cdh1	No	Not done	[130]
Let-7 f	Breast cancer	OncomiR or Tumour promoter	Not found	CXCL12	No	Not done	[127]
miR-410	Non-small cell lung cancer	OncomiR or Tumour promoter	5'TTATAT3’ 3'AAUAUA5’ *	CXCR4, Sox2, Wnt/β-catenin signaling	No	Not done	[128]

*miRDB, ** TargetScanHuman Release 7.2.

Figure 1. UCSC Genome Browser (hg19 build) depiction of 4 conserved putative microRNA binding sites within the 3’ UTR (gold bar) of CXCR4 (blue and black bars) as predicted by in silico analysis using TargetScanHuman 7.2. Site type prediction: Red miR = exact match to positions 2–8 of the mature miRNA, Purple miR = an exact match to positions 2–8 of the mature miRNA followed by an ‘A.’

Fang Y, Sun B, Wang J, et al. miR-622 inhibits angiogenesis by suppressing the CXCR4-VEGFA axis in colorectal cancer. Gene. 2019;699:37–42.

 Google Scholar

Duan FT, Qian F, Fang K, et al. miR-133b, a muscle-specific microRNA, is a novel prognostic marker that participates in the progression of human colorectal cancer via regulation of CXCR4 expression. Mol Cancer. 2013;12(1):164.

 Google Scholar

Shirafkan N, Shomali N, Kazemi T, et al. microRNA-193a-5p inhibits migration of human HT-29 colon cancer cells via suppression of metastasis pathway. J Cell Biochem. 2019;5:8775–8783.

 Google Scholar

Liang Z, Bian X, Shim H. Inhibition of breast cancer metastasis with microRNA-302a by downregulation of CXCR4 expression. Breast Cancer Res Treat. 2014;146(3):535–542.

 Google Scholar

Song L, Liu D, Wang B, et al. miR-494 suppresses the progression of breast cancer in vitro by targeting CXCR4 through the Wnt/beta-catenin signaling pathway. Oncol Rep. 2015;34(1):525–531.

 Google Scholar

Zheng T, Chou J, Zhang F, et al. CXCR4 3'UTR functions as a ceRNA in promoting metastasis, proliferation and survival of MCF-7 cells by regulating miR-146a activity. Eur J Cell Biol. 2015;94(10):458–469.

 Google Scholar

Xue Y, Xu W, Zhao W, et al. miR-381 inhibited breast cancer cells proliferation, epithelial-to-mesenchymal transition and metastasis by targeting CXCR4. Biomed Pharmacother. 2017;86:426–433.

 Google Scholar

Zhu B, Xi X, Liu Q, et al. MiR-9 functions as a tumor suppressor in acute myeloid leukemia by targeting CX chemokine receptor 4. Am J Transl Res. 2019;11(6):3384–3397.

 Google Scholar

Alfano D, Gorrasi A, Li Santi A, et al. Urokinase receptor and CXCR4 are regulated by common microRNAs in leukaemia cells. J Cell Mol Med. 2015;19(9):2262–2272.

 Google Scholar

Li H, Yao G, Feng B, et al. Circ_0056618 and CXCR4 act as competing endogenous in gastric cancer by regulating miR-206. J Cell Biochem. 2018;119(11):9543–9551.

 Google Scholar

Bao W, Fu HJ, Xie QS, et al. HER2 interacts with CD44 to up-regulate CXCR4 via epigenetic silencing of microRNA-139 in gastric cancer cells. Gastroenterology. 2011;141(6):2076–2087. e2076.

 Google Scholar

Feng JA. Target research on tumor biology characteristics of mir-155-5p regulation on gastric cancer cell. Pak J Pharm Sci. 2016;29(2 Suppl):711–718.

 Google Scholar

He B, He Y, Shi W, et al. Bioinformatics analysis of gene expression alterations in microRNA122 knockout mice with hepatocellular carcinoma. Mol Med Rep. 2017;15(6):3681–3689.

 Google Scholar

Liu H, Liu Y, Liu W, et al. EZH2-mediated loss of miR-622 determines CXCR4 activation in hepatocellular carcinoma. Nat Commun. 2015;6(1):8494.

 Google Scholar

Shen PF, Chen XQ, Liao YC, et al. MicroRNA-494-3p targets CXCR4 to suppress the proliferation, invasion, and migration of prostate cancer. Prostate. 2014;74(7):756–767.

 Google Scholar

Bakkar A, Alshalalfa M, Petersen LF, et al. microRNA 338-3p exhibits tumor suppressor role and its down-regulation is associated with adverse clinical outcome in prostate cancer patients. Mol Biol Rep. 2016;43(4):229–240.

 Google Scholar

Leone V, D’Angelo D, Rubio I, et al. MiR-1 is a tumor suppressor in thyroid carcinogenesis targeting CCND2, CXCR4, and SDF-1alpha. J Clin Endocrinol Metab. 2011;96(9):E1388–1398.

 Google Scholar

Qian Y, Wang X, Lv Z, et al. MicroRNA126 is downregulated in thyroid cancer cells, and regulates proliferation, migration and invasion by targeting CXCR4. Mol Med Rep. 2016;14(1):453–459.

 Google Scholar

Yu T, Liu K, Wu Y, et al. MicroRNA-9 inhibits the proliferation of oral squamous cell carcinoma cells by suppressing expression of CXCR4 via the Wnt/beta-catenin signaling pathway. Oncogene. 2014;33(42):5017–5027.

 Google Scholar

Mesgarzadeh AH, Aali M, Farhadi F, et al. Transfection of microRNA-143 mimic could inhibit migration of HN-5 cells through down-regulating of metastatic genes. Gene. 2019;716:144033.

 Google Scholar

Zhao R, Ni J, Lu S, et al. CircUBAP2-mediated competing endogenous RNA network modulates tumorigenesis in pancreatic adenocarcinoma. Aging (Albany NY). 2019;11(19):8484–8501.

 Google Scholar

Pazzaglia L, Pollino S, Vitale M, et al. miR494.3p expression in synovial sarcoma: role of CXCR4 as a potential target gene. Int J Oncol. 2019;54(1):361–369.

 Google Scholar

Zhu Y, Tang L, Zhao S, et al. CXCR4-mediated osteosarcoma growth and pulmonary metastasis is suppressed by microRNA-613. Cancer Sci. 2018;109(8):2412–2422.

 Google Scholar

Li W, Zhao W, Lu Z, et al. Long noncoding RNA GAS5 promotes proliferation, migration, and invasion by regulation of miR-301a in esophageal cancer. Oncol Res. 2018;26(8):1285–1294.

 Google Scholar

Zhang M, Zhang L, Cui M, et al. miR-302b inhibits cancer-related inflammation by targeting ERBB4, IRF2 and CXCR4 in esophageal cancer. Oncotarget. 2017;8(30):49053–49063.

 Google Scholar

Qin L, Deng HY, Chen SJ, et al. miR-139 acts as a tumor suppressor in T-cell acute lymphoblastic leukemia by targeting CX chemokine receptor 4. Am J Transl Res. 2017;9(9):4059–4070.

 Google Scholar

Luo HN, Wang ZH, Sheng Y, et al. MiR-139 targets CXCR4 and inhibits the proliferation and metastasis of laryngeal squamous carcinoma cells. Med Oncol. 2014;31(1):789.

 Google Scholar

Hersi HM, Raulf N, Gaken J, et al. MicroRNA-9 inhibits growth and invasion of head and neck cancer cells and is a predictive biomarker of response to plerixafor, an inhibitor of its target CXCR4. Mol Oncol. 2018;12(12):2023–2041.

 Google Scholar

Lu J, Luo H, Liu X, et al. miR-9 targets CXCR4 and functions as a potential tumor suppressor in nasopharyngeal carcinoma. Carcinogenesis. 2014;35(3):554–563.

 Google Scholar

Yao C, Huang S, Wu J, et al. MicroRNA-140 inhibits tumor progression in nasopharyngeal carcinoma by targeting CXCR4. Int J Clin Exp Pathol. 2017;10(7):7750–7759.

 Google Scholar

Shi Y, Chen C, Yu SZ, et al. miR-663 suppresses oncogenic function of CXCR4 in glioblastoma. Clin Cancer Res. 2015;21(17):4004–4013.

 Google Scholar

Xu X, Cao L, Zhang Y, et al. MicroRNA-1246 inhibits cell invasion and epithelial mesenchymal transition process by targeting CXCR4 in lung cancer cells. Cancer Biomark. 2018;21(2):251–260.

 Google Scholar

Yu X, Shi W, Zhang Y, et al. CXCL12/CXCR4 axis induced miR-125b promotes invasion and confers 5-fluorouracil resistance through enhancing autophagy in colorectal cancer. Sci Rep. 2017;7(1):42226.

 Google Scholar

Zhu G, Liu X, Su Y, et al. Knockdown of urothelial carcinoma-associated 1 suppressed cell growth and migration through regulating miR-301a and CXCR4 in osteosarcoma MHCC97 cells. Oncol Res. 2018;27(1):55–64.

 Google Scholar

Zhou J, Liu R, Wang Y, et al. miR-199a-5p regulates the expression of metastasis-associated genes in B16F10 melanoma cells. Int J Clin Exp Pathol. 2014;7(10):7182–7190.

 Google Scholar

Egea V, Kessenbrock K, Lawson D, et al. Let-7f miRNA regulates SDF-1alpha- and hypoxia-promoted migration of mesenchymal stem cells and attenuates mammary tumor growth upon exosomal release. Cell Death Dis. 2021;12(6):516.

 Google Scholar

Ke X, Yuan Y, Guo C, et al. MiR-410 induces stemness by inhibiting Gsk3beta but upregulating beta-catenin in non-small cells lung cancer. Oncotarget. 2017;8(7):11356–11371.

 Google Scholar