Ruminal methanogenesis and biohydrogenation reduction potential of papaya (Carica papaya) leaf: an in vitro study

Figures & data

Table 1. Ingredients and chemical composition and fatty acid content of substrates used for the in vitro incubation.

	PL	AH	Concentrate
Ingredients, g/kg DM
Corn	–	–	254.40
Soybean meal	–	–	190.00
Palm kernal cake	–	–	358.70
Rice bran	–	–	116.90
Palm kernal oil	–	–	50.00
Ammonium chloride	–	–	10.00
Vitamin premix	–	–	10.00
Mineral premix	–	–	10.00
Chemical composition
DM, g/kg	833.00	907.10	915.11
CP, g/kg DM	256.00	203.00	167.09
NDF, g/kg DM	312.05	517.00	244.00
ADF, g/kg DM	266.02	334.04	117.00
EE, g/kg DM	21.40	34.70	42.20
Fatty acid, % of identified FA
C12:0	1.26	2.18	1.71
C14:0	0.98	1.61	1.63
C16:0	16.69	28.20	22.83
C16:1n-7	1.87	3.02	0.50
C18:0	12.98	7.44	4.72
C18:1n-9	16.27	5.40	16.4
C18:2n-6	40.67	42.59	43.92
C18:3n-3	9.28	9.56	8.29
n-3 PUFA	9.28	9.56	8.29
n-6 PUFA	40.67	42.59	43.92
MUFA	1.87	3.02	0.50
Total SFA	31.91	39.43	30.89
C18-PUFA	66.22	57.55	68.61

PL: papaya leaf; AH: alfalfa hay; DM: dry matter; CP: crude protein; NDF: neutral detergent fibre; ADF: acid detergent fibre; EE: ether extract; C12:0: lauric acid; C14:0: myristic acid; C16:0: palmitic acid; C18:0: stearic acid (SA); C18:1n-9: oleic acid (OA); C18:2n-6: linoleic acid (LA); C18:3n-3: linolenic acid (LNA); n-3 PUFA: C18:3n-3; n-6 PUFA: C18:2n-6; MUFA: C16:1n-7; total SFA: (C12:0 + C14:0 + C16:0 + C18:0); C18-PUFA: (C18:1n-9 + C18:2n-6 + C18:3n-3).

Table 2. Polymerase chain reaction primers used for amplifying target bacteria in the rumen.

Microorganism	Sequence 5′–3′	Reference
Total bacteria F^1	CGGCAACGAGCGCAACCC	Koike and Kobayashi (2001)
Total bacteria R^2	CCATTGTAGCACGTGTGTAGCC
Butyrivibrio fibrisolvens F^1	TAACATGAGTTTGATCCTGGCTC	Liu et al. (2012)
Butyrivibrio fibrisolvens R^2	CGTTACTCACCCGTCCGC
Total methanogen F^1	CGGTCTTGCCCAGCTCTTATTC	Zhang et al. (2008)
Total methanogen R^2	CCGGAGATGGAACCTGAGAC
Total protozoa F^1	CTTGCCCTCYAATCGTWCT
Total protozoa R^2	GCTTTCGWTGGTAGTGTATT	Sylvester et al. (2004)

F¹: forward; R²: reverse.

Figure 1. Cumulative gas production of control (CON) and different inclusion levels of papaya leaf at different times of incubation. CON: 50% concentrate + 50% AH, LPL: 15% replacement of AH substrate by PL, MPL: 25% replacement by PL, HPL: 50% replacement by PL. Vertical bars are standard error.

Table 3. Effect of the addition of different levels of papaya leaf on rumen fermentation parameters after in vitro incubation with rumen fluid from goats.

	Experimental diets					p value
Parameters	CON^1	LPL^2	MPL^3	HPL^4	SEM	Linear	Quadratic
pH	7.38^a	7.36^ab	7.35^b	7.37^ab	0.00	0.01	0.58
NH3N, mg/dl	18.23^b	23.05^a	23.44^a	22.55^a	0.87	0.00	0.05
CH4, Ml/0.25g DM	7.10^a	5.93^ab	4.65^b	4.46^b	0.47	0.03	0.35
Acetic, mol/100 mol	68.06^a	56.91^b	59.06^ab	67.30^a	3.28	0.06	0.11
Propionic, mol/100 mol	33.46^ab	30.09^b	30.25^b	37.26^a	1.71	0.20	0.41
Butyric, mol/100 mol	3.52	3.00	3.39	3.65	0.22	0.68	0.11
Total VFA, mM/l	105.05^ab	90.01^c	92.71^bc	108.22^a	4.25	0.05	0.10
Acetic/propionic ratio	2.04^a	1.89^ab	1.95^ab	1.80^b	0.05	0.27	0.13

1 CON: control (50% concentrate + 50% AH);

2 LPL: 15% replacement of AH substrate by PL;

3 MPL: 25% replacement by PL;

4 HPL: 50% replacement by PL; SEM: standard error of mean; PL, papaya leaf.

^a,b,cDifferent letters in each row denote significant difference at p<0.05.

Table 4. Phenolic compound present in papaya leaf.

	TP (GAE/g)	TT (GAE/g)	CT (CTE/g)	HT (GAE/g)
PL	30.31	28.36	17.39	10.96

TP: total phenol; TT: total tannin; CT: condensed tannin; HT: hydrolysed tannin; PL: papaya leaf; GAE: gallic acid equivalent; CTE: catechin equivalent; SEM: standard error of mean.

Figure 2. Effect of incremental levels of papaya leaf on the percentage of variation with respect to the control (i.e. without PL) of C18:1n-9, C18:2n-6, C18:3n-3 and C18 PUFA (C18:1n-9 + C18:2n-6 +C18:3n-3) content after 24 h in vitro incubation with rumen inoculum from goats. Differences (p < 0.05) compared with the control (CON). Vertical bars are standard error of the mean, ^a,bdifferent letters denote significant difference at p<0.05.

Figure 3. Production of biohydrogenation intermediates after 24 h of incubation. CON: 50% concentrate + 50% AH, LPL: 15% replacement of AH substrate by PL, MPL: 25% replacement by PL, HPL: 50% replacement by PL. Vertical bars are standard error of the mean; ^a,bdifferent letters denote significant difference at p<0.05; C18:1t-11, vaccenic acid; c9t11 CLA, rumenic acid.

Table 5. Effect of the addition of different levels of papaya leaf on rumen concentration of fatty acids at 0 h and 24 h of in vitro incubation with rumen fluid from goat.

		Experimental diets					p value
FA (g/100g)	Time	CON	LPL	MPL	HPL	SEM	Linear	Quadratic
C14:0	0 h	1.77^a	1.79^a	1.69^ab	1.35^b	0.13	0.04	0.88
	24 h	2.70	2.77	3.15	3.04	0.53	0.70	0.90
C16:0	0 h	19.25	20.96	22.26	23.49	1.39	0.28	0.92
	24 h	24.97	25.74	26.27	20.34	2.40	0.31	0.92
C16:1n-7	0 h	1.51	0.87	0.76	0.82	0.23	0.06	0.01
	24 h	3.73^a	1.20^b	1.91^b	2.75^ab	0.52	0.01	0.04
C18:0	0 h	25.97	25.07	25.55	24.12	1.39	0.40	0.47
	24 h	34.40	31.99	32.16	29.47	1.72	0.53	0.58
C18:1t-11	0 h	0.23	0.21	0.27	0.23	0.04	0.44	0.91
	24 h	2.39	2.55	2.73	3.46	0.34	0.75	0.96
C18:1 n-9	0 h	13.47	13.44	12.41	14.20	1.05	0.34	0.56
	24 h	4.08	4.15	3.34	5.33	0.80	0.67	0.80
C18:2 n-6	0 h	29.06	28.93	22.70	22.73	3.55	0.24	0.25
	24 h	5.47	7.72	5.69	7.12	0.90	0.53	0.54
C18:3 n-3	0 h	1.33^ab	1.01^b	2.05^a	1.87^ab	0.28	0.02	0.03
	24 h	0.31	0.30	0.60	0.55	0.09	0.12	0.14
c9t11CLA	0 h	2.13^c	3.08^bc	5.13^a	4.53^ab	2.13^c	0.03	0.78
	24 h	9.63	15.62	18.05	15.52	3.57	0.10	0.83
t10c12CLA	0 h	2.36	1.49	3.13	1.45	0.74	0.96	0.49
	24 h	1.72	1.86	0.91	1.88	0.39	0.97	0.51
C20:4 n-6	0 h	0.97	0.88	1.04	1.50	0.27	0.06	0.23
	24 h	2.73^a	1.47^b	1.11^b	1.63^b	0.27	0.02	0.31
C20:5 n-3	0 h	0.56^b	0.73^b	0.61^b	1.32^a	0.17	0.02	0.60
	24 h	1.97	1.25	1.32	2.15	0.33	0.36	0.66
C22:5 n-3	0 h	0.40	0.30	1.17	1.27	0.31	0.26	0.50
	24 h	3.52	1.66	0.82	3.27	1.15	0.29	0.53
C22:6 n-3	0 h	0.94	1.17	1.18	1.06	0.18	0.77	0.51
	24 h	2.33^ab	1.64^b	1.90^b	3.42^a	0.40	0.04	0.63
SFA	0 h	47.00	47.83	49.51	48.97	2.46	0.72	0.72
	24 h	62.08	60.51	61.58	52.87	3.16	0.78	0.78
MUFA	0 h	14.99	14.32	13.18	15.02	1.14	0.05	0.62
	24 h	7.81	5.36	5.25	8.08	1.05	0.27	0.78
PUFA n-6	0 h	30.04	29.81	23.75	24.23	3.51	0.14	0.31
	24 h	8.20	9.19	6.80	8.76	1.03	0.42	0.57
PUFA n-3	0 h	3.22^b	3.23^b	5.02^a	5.53^a	0.54	0.03	0.16
	24 h	8.14^ab	4.87^b	4.65^b	9.41^a	1.29	0.04	0.24
C18 UFA	0 h	48.60	48.18	45.71	45.04	2.67	0.40	0.25
	24 h	23.62^b	32.22^ab	31.33^ab	33.87^a	3.09	0.04	0.47

SFA: C14:0 + C16:0 + C18:0; MUFA: sum of C14:1 + C16:1n-7 + C17:1 + C18:1n-9; PUFA n-3: sum of C18:3n-3 + C20:5n-3 + C22:5n-3 + C22:6n-3; PUFA n-6: sum of 18:2n-6 + 20:4n-6; C18 PUFA: sum of (C18:3n-3 + C18:2n-6 + C18:1n-9); CON: 50% concentrate + 50% AH; LPL: 15% replacement of AH substrate by PL; MPL: 25% replacement by PL; HPL: 50% replacement by PL.; SEM: standard error of mean.

^a,b,cDifferent letter in each row denotes significant difference at p<0.05.

Table 6. Effect of papaya leaf on the population of bacteria and protozoa at 24 h of in vitro incubation.

		Experimental diets				p value
Log10cell/l	CON	LPL	MPL	HPL	SEM	Linear	quadratic
Total bacteria	10.53^b	10.57^b	10.88^ab	11.04^a	0.12	0.06	0.39
B. fibrisolvens	3.37^b	3.57^b	4.20^a	4.36^a	0.16	0.00	0.30
Methanogens	9.06^a	8.66^a	7.87^b	7.64^b	0.18	0.00	0.40
Total protozoa	6.59	6.52	6.22	5.67	0.33	0.43	0.77

CON: 50% concentrate + 50% alfalfa; LPL: 15% replacement of alfalfa substrate by PL; MPL: 25% replacement by PL; HPL: 50% replacement by PL; SEM: standard error of mean.

^a,bDifferent letters in each row denote significant difference at p<0.05.

Koike S, Kobayashi Y. 2001. Development and use of competitive PCR assays for the rumen cellulolytic bacteria: Fibrobacter succinogenes, Ruminococcus albus and Ruminococcus flavefaciens. FEMS Microbiol Lett. 204:361–366.

 PubMed Web of Science ®Google Scholar

Liu H, Vaddella V, Zhou D. 2012. Effects of chestnut tannins and coconut oil on growth performance, methane emission, ruminal fermentation, and microbial populations in sheep. J Dairy Sci. 94:6069–6077.

 Web of Science ®Google Scholar

Zhang CM, Guo YQ, Yuan ZP, Wu YM, Wang JK, Liu JX, Zhu WY. 2008. Effect of octadeca carbon fatty acids on microbial fermentation, methanogenesis and microbial flora in vitro. Anim Feed Sci Technol. 146:259–269.

 Web of Science ®Google Scholar

Sylvester JT, Karnati SKR, Yu Z, Morrison M, Firkins JL. 2004. Development of an assay to quantify rumen ciliate protozoal biomass in cows using real-time PCR. J Nutr. 134:3378–3380.

 PubMed Web of Science ®Google Scholar