Evaluation of growth performance and muscle marker genes expression in four different broiler strains in Jordan

Figures & data

Table 1. Composition of the experimental diets.

Ingredient, % as fed	Starter diet	Grower diet
	1 to 21 d	22 to 28 d
Corn	57.00	64.00
Soybean meal	32.00	25.00
Concentrate	6.00	5.50
Soybean oil	1.00	2.00
Dicalcium phosphate	1.10	0.90
Limestone	1.50	1.50
Mineral-vitamin premix^a	0.75	0.50
Salt (NaCl)	0.25	0.25
DL-Methionine	0.23	0.21
L-Lysine HCl	0.17	0.14
Calculated nutritive value, g kg^−1 DM^b
AMEn, kcal kg^−1^c	3120.00	3185.00
Crude protein, DM %	22.30	19.20
Ether extract, DM %	4.90	7.80

^a Provided the following per kilogram of diet: vitamin A: 11,166 U; cholecalciferol: 2500 U; vitamin E: 80 mg; menadione: 2.50 mg; vitamin B₁₂: 0.02 mg; folic acid: 1.17 mg; choline; 379 mg; D-pantothenic acid: 12.50 mg; riboflavin: 7.0 mg; niacin: 41.67 mg; thiamine: 2.17 mg; D-bioyin: 0.18 mg; pyridoxine: 4.0 mg; ethoxyquin: 0.09 mg; Mn (MnO₂): 73 mg; Zn (ZnO): 55 mg; Fe (FeSO₄): 45 mg; Cu (CuSO₄): 20 mg; I (CaI₂O₆): 0.62 mg; and Se (Na₂SeO₃): 0.3 mg.

^b DM stands for dry matter content.

^c AME_n stands for Apparent metabolisable energy.

Table 2. Oligonucleotides used for expression analysis of chicken genes and the annealing temperatures (AT).

Gene	Primer sequences	Annealing temperature
cMyoD	(F) 5′TACCCAGTGCTGGAGCACTA3′	57 °C
	(R) 5′GTCTTGGAGCTTGGCTG AACT3′
cMyoG	(F) 5′AGCAGCCTCAACCAGCAGGA3′	58 °C
	(R) 5′TCTGCCTGGTCATCGCTCAG3′
cMSTN	(F) 5′ATGCAAAAGCTAGCAGTC3′	52 °C
	(R) 5′TCATGAGCACCCGCAACGAT3′
cIGF-I	(F) 5′-CGTACAGAGCGTGCAGATT3′	55 °C
	(R) 5′ CGTAC AGAGCGTGCAGATT3′
cGAPDH	(F) 5′GGTGGCCATCAATGA3′	52 °C
	(R) 5′CAGTGGTCATAAGACCC-3′

Table 3. Least squares mean for broiler initial body, final body, hot carcase and cold carcase weights and dressing percentages as affected by strain.

Strain	Initial body weight, g ± SE	Final body weight at 28 days, g ± SE	Hot carcase weight, g ± SE	Cold carcase weight, g ± SE	Dressing percentage, %±SE
Cobb	48.620 ± 0.760^a	1588.150 ± 25.900^c	1275.060 ± 33.670^b	1293.280 ± 32.820^b	80.310 ± 1.260
Hubbard	49.620 ± 0.760^a	1678.730 ± 28.430^b	1327.340 ± 36.950^b	1367.170 ± 36.010^b	79.080 ± 1.390
Indian River	50.080 ± 0.760^a	1878.470 ± 30.850^a	1460.660 ± 40.100^a	1489.250 ± 39.080^a	77.850 ± 1.510
Ross	38.500 ± 0.760^b	1688.510 ± 48.670^b	1278.010 ± 63.270^b	1285.730 ± 61.660^b	75.370 ± 2.380
Covariate p-value		.308	.747	.643	.576
Strain p-value	<.000	<.000	.000	.001	.182

Means followed by different superscripts within the same column are significantly different at (p ≤ .05).

Dressing percentage is expressed as hot carcase weight (g)/final live body weight (g).

Table 4. Least squares mean for carcase cuts and abdominal fat percentages as affected by strain (percentages expressed as a part of cold carcase weight).

Strain	Breast, %	Leg, %	Wing, %	Back, %	Neck, %	Abdominal fat, %	Breast fillet, %
Cobb	34.470^b	26.410^a	8.240	17.9400^b	5.630	1.480^a	23.540
Hubbard	36.900^a	24.610^b	8.580	19.9600^a	6.350	0.730^c	26.190
Indian River	37.510^a	25.570^a	8.550	19.1300^a	5.860	0.570^c	24.280
Ross	37.530^a	26.630^a	8.600	17.9100^b	5.940	0.930^b	25.600
SEM	0.680	0.530	0.190	0.7100	0.310	0.070	1.190
Strain p-value	.007	.038	.526	.132	.423	<.000	.385

Means followed by different superscripts within the same column are significantly different at (p ≤ .05).

Table 5. Least squares mean for non-carcase components as affected by strain (percentages expressed as a part of cold carcase weight).

	Per cent mean weight of cold carcase weight
Strain	Gizzard	Proventriculus	Liver	Heart
Cobb	1.340^b	0.490	2.850	0.780
Hubbard	1.440^a	0.570	2.940	0.840
Indian River	1.300^b	0.480	3.080	0.883
Ross	1.730^a	0.540	3.210	0.885
SEM	0.100	0.040	0.230	0.040
Treatment p-value	.050	.402	.709	.386

Means followed by different superscripts within the same column are significantly different at (p ≤ .06).

Table 6. Least squares means for meat quality parameters as affected by strain.

Strain	pH	Colour			Cooking loss, %	Water holding capacity, %	Shear force, kg/cm^2
		Lightness (L*)	Redness (a*)	Yellowness (b*)
Cobb	6.012	4348.300	297.000	1846.000^a	29.370^a	35.910	2.790^b
Hubbard	6.036	4295.800	317.100	1784.500^a	27.480^a	37.500	2.490^b
Indian River	5.776	4080.110	496.110	1465.280^b	28.650^a	34.710	3.020^a
Ross	6.042	4383.100	304.800	1684.300^a	26.520^b	35.500	2.230^c
SEM	0.240	236.060	79.470	95.500	0.770	1.890	0.190
Treatment p-value	.354	.813	.270	.047	.058	.773	.040

* Means followed by different superscripts within the same column are significantly different at (p ≤ .05) (Honikel 1998).

% cooking loss: [(raw weight − cooked weight)/(raw weight)] × 100.

Figure 1. Growth and consumption parameters of tested broiler strains during four weeks of experimentation. Data presented as LSMeans ± SE. Means without a common superscript differ significantly (p ≤ .05); *means differ significantly (p < .05, see text).

Figure 2. Normalized fold expression of IGF-I, MYO-D, MYO-G and MSTN genes in four broiler strains (IND: Indian River, HUB: Hubbard, Cobb 500, Ross 308). Different letters (a, b, c, d) indicate significant difference among strains.

Honikel KO. 1998. Reference methods for the assessment of physical characteristics of meat. Meat Sci. 49:447–457.

 PubMed Web of Science ®Google Scholar