Phytobiotic role of essential oil-loaded microcapsules in improving the health parameters in Clostridium perfringens-infected broiler chickens

Figures & data

Table 1. Experimental treatments.

Treatments	Diet	Status
T1	No additive	Uninfected
T2	No additive	Infected
T3	No additive + 0.5 kg of microencapsulated EO/ton of the feed	Infected
T4	No additive + 1 kg of microencapsulated EO/ton of the feed	Infected
T5	No additive + 2 kg of microencapsulated EO/ton of the feed	Infected
T6	No additive + 1 kg of Digestarom PEP/ton of the feed	Infected
T7	No additive + 0.4 g of oxytetracycline/ton of the feed	Infected

Digestarom PEP: A commercial natural product based on the matrix-encapsulated mixture of the natural extracts from aromatic plants with thymol, carvacrol, anethol, and limonene.

Oxytetracycline: A common synthetic antibiotic growth promoter.

Infection is performed by using 2 mL of peptone water containing 1 × 10⁸ CFU of C. perfringens.

EO: essential oils.

Table 2. Diet ingredients and chemical analysis.

Ingredients	Starter (1–14 day)	Grower (15–23 day)
Corn, %	49.04	54.06
Soybean meal, %	41.76	39.47
Soybean oil, %	4.48	2.1
Dicalcium phosphate, %	1.98	1.79
Calcium carbonate, %	1.21	1.13
Salt, %	0.42	0.42
DL-methionine, %	0.38	0.28
L-lysin, %	0.25	0.26
Vitamin supplement^a, %	0.25	0.25
Mineral supplement^b, %	0.25	0.25
Chemical analysis^c
Metabolizable energy (Kcal/kg)	3000	3150
Crude protein, %	23	22
Lysin, %	1.45	1.40
Methionine, %	0.72	0.10
Arginine, %	1.49	1.43
Methionine + Cysteine, %	1.09	1.96
Calcium, %	1	0.92
Phosphorous, %	0.5	0.46
Sodium, %	0.18	0.18

^aVitamin supplement is provided per kg of diet: vitamin A (retinylacetate), 9500 U; vitamin E (DL-α-tocopherol acetate), 30 U; vitamin K₃ (menadione sodium bisulfate), 2.65 mg; vitamin D₃ (cholecalciferol), 2500 U; vitamin B₁₂ (cyanocobalamin), 0.025 mg; biotin, 0.30 mg; nicotinic acid, 50 mg; folic acid, 1.25 mg; d-pantothenic acid, 12 mg; riboflavin, 6.5 mg; pyridoxine hydrochloride, 6.0 mg; thiamine mononitrate, 3 mg.

^bMineral supplement is provided per Kg of diet: zinc, 80 mg; manganese, 100 mg; copper 8 mg; iron, 80 mg; iodine, 0.35 mg; selenium, 0.15 mg.

^cValues are calculated based on the analysed experimental diet data.

Table 3. Characteristics of the primers used in this study, and ileal and caecum microbial population analysis.

Gene	Forward (5′→3′)	Reverse (5′→3′)	Reference
Occludin	gagcccagactaccaaagcaa	Gcttgatgtggaagagcttgttg	(Teshfam et al. 2006)
iNOS	aggccaaacatcctggaggtc	Tcatagagacgctgctgccag	(Chen et al. 2015)
SOD	ttgtctgatggagatcatggcttc	Tgcttgccttcaggattaaagtgag	(Tang et al. 2019)
β-Actin	actggatttcgagcaggagat	Ttagaagcatttgcggtggacaa	(Teshfam et al. 2006)

Table 4. List of the primers applied for ileum and caecum microbial population analysis.

Target	Forward (5′→3′)	Reverse (5′→3′)	References
C. perfringens	AAAGATGGCATCATCATTCAAC	TACCGTCATTATCTTCCCCAAA	(Chen et al. 2015)
Lactic acid bacteria (LABs)	Catccagtgcaaacctaagag	Gatccgcttgccttcgca	(Rezaei et al. 2015)
Total bacteria	Catccagtgcaaacctaagag	Gatccgcttgccttcgca

Figure 1. Scanning electron micrographs of the microcapsules containing EO blend.

Table 5. Main phytochemical contents of the microcapsules.

Compounds	Total oil, %
Thymol	42.39
Carvacrol	27.18
p-Cymene	14.73
γ-Terpinene	11.68
Menthol	8.43
Caryophyllene	5.28
Total	97.8

Figure 2. In vitro percentage release of phenolic compounds in the microcapsule core in simulated gastric fluid and simulated intestinal fluid.

Table 6. Retention rates of phenolic compounds (%) in the digesta of the different GIT segments of 18-day-old broiler chickens after the oral gavage of unencapsulated and encapsulated EOs.

GIT segments	Phenolic compounds, %			SEM
	Hour post-gavage	Unencapsulated EO	Encapsulated EO
Crop	1	64.2^b	74.3^a	4.38
	3	6.38^b	15.38^a	3.96
Gizzard	1	9.7	11.38	1.73
	3	5.46	8.18	2.24
Duodenum and jejunum	1	2.2	4.7	1.97
	3	33.6	28.9	3.81
Ileum	1	0.8	1.1	0.62
	3	3.68^b	19.7^a	3.19
Caecum and colon	1	0.5	0.5	0.16
	3	1.9^b	4.7^a	1.1
Disappeared phenolic compounds, %	1	22.6^a	7.99^b	4.26
	3	48.98^a	23.14^b	7.38

The means with different letters in the same row are significantly different (p < .05).

Phenolic compounds are determined equivalent to thymol as standards relative to the total phenolic compounds orally gavaged in chickens in the various GIT segments.

EO: essential oils; GIT: gastrointestinal tract.

Table 7. Final weight, total feed intake, FCR, pH in the ileum and caecum of the differently-treated chickens.

Treatments	Final weight, g	Total feed intake, g	FCR
T1	685.3^c	809.2^c	1.18^ab
T2	661.2^e	813.4^bc	1.23^a
T3	676.6^c	819.2^b	1.21^a
T4	707.6^b	831.2^a	1.17^b
T5	729.7^a	835.5^a	1.15^b
T6	727.4^a	832.5^a	1.14^b
T7	675.9^c	812.3^bc	1.20^a
SEM	7.1	4.7	0.01
p-Value	.03	0/04	.04

The means with different letters in the same column are significantly different (p < .05).

T1: Uninfected; T2: Infected; T3: Infected + 0.5 kg/ton; T4: Infected + 1 kg/ton; T5: Infected + 2 kg/ton; T6: Infected + DPEP; T7: Infected + Oxy 0.4 kg/ton; FCR: Feed conversion ratio.

The experiment was conducted for 23 days.

Table 8. Antioxidant activity of serum and breast meat, and total phenolic content of the meat.

Treatments	Breast meat		Serum
	Total phenolic content, %*	MDA, %*	DPPH scavenging activity, %
T1	115.3^d	100.0^d	18.3^d
T2	117.5^d	154.7^a	15.8^d
T3	124.9^d	147.3^a	28.6^c
T4	142.7^c	134.9^b	38.9^b
T5	169.4^a	121.6^c	48.2^a
T6	152.7^a	118.9^c	54.1^a
T7	119.4^d	137.2^b	16.4^d
SEM	4.7	3.9	5.0

The means with different letters in the same column are significantly different (p < .05).

T1: Uninfected; T2: Infected; T3: Infected + 0.5 kg/ton; T4: Infected + 1 kg/ton; T5: Infected + 2 kg/ton; T6: Infected + DPEP; T7: Infected + Oxy 0.4 kg/ton.

*Relative to the control (T1).

MDA: Malondialdehyde; DPPH: 2,2-diphenyl-1-picrylhydrazyl.

Table 9. Liver enzymes and immunoglobulins of serum, and total phenolics of breast meat.

Treatments	Liver enzymes		Immunoglobulins
	ALT, U/L	AST, U/L	IgG, ng/mL	IgA, ng/mL
T1	23.5^c	195.7^e	65.3^b	39.7^b
T2	36.3^a	236.3^a	54.7^c	31.2^d
T3	29.3^b	232.7^ab	56.5^c	35.3^c
T4	26.7^bc	218.7^c	69.7^b	36.5^bc
T5	24.7^c	207.3^d	77.7^a	44.3^a
T6	25.3^bc	209.8^d	79.3^a	46.1^a
T7	33.9^a	224.6^bc	56.8^c	35.9^c
SEM	2.1	4.3	3.6	1.9

The means with different letters in the same column are significantly different (p < .05).

T1: Uninfected; T2: Infected; T3: Infected + 0.5 kg/ton; T4: Infected + 1 kg/ton; T5: Infected + 2 kg/ton; T6: Infected + DPEP; T7: Infected + 0.4 kg/ton.

ALT: Alanine Aminotransferase; AST: aspartate aminotransferase; IgG: Immunoglobulin G; IgA: Immunoglobulin A.

Table 10. Gene expression analysis of ileum in the treated groups.

Treatments	Genes (fold changes)
	Occludin	iNOS	SOD
T1	1.0^c	1.0^e	1.0^c
T2	0.38^d	5.8^a	0.53^d
T3	0.96^c	4.6^b	0.79^cd
T4	1.59^b	3.2^c	1.69^b
T5	2.47^a	2.4^d	2.93^a
T6	2.58^a	2.2^d	3.10^a
T7	1.38^bc	3.4^c	0.86^cd
SEM	0.18	0.3	0.20

The means with different letters in the same column are significantly different (p < .05).

T1: Uninfected; T2: Infected; T3: Infected + 0.5 kg/ton; T4: Infected + 1 kg/ton; T5: Infected + 2 kg/ton; T6: Infected + DPEP; T7: Infected + 0.4 kg/ton.

Table 11. Ileum and caecum microbial population analysis using real-time PCR among the treated groups.

Treatments	Ileum		Caecum		Caecal pH
	LABs	C. perfringens	LABs	C. perfringens
T1	1.0^b	1.0^f	1.0^b	1.0^e	6.8^c
T2	0.58^cde	5.95^a	0.72^c	3.9^a	7.5^a
T3	0.68^cd	4.60^b	0.77^c	3.2^b	7.2^b
T4	0.79^c	2.60^d	0.89^b	2.1^c	6.7^c
T5	0.86^bc	2.10^e	0.97^b	1.4^d	6.5^c
T6	1.60^a	2.20^e	1.40^a	1.3^d	6.2^d
T7	0.38^e	3.29^c	0.43^d	2.3^c	7.3^b
SEM	0.10	0.32	0.05	0.1	0.1

The means with different letters in the same column are significantly different (p < .05).

T1: Uninfected; T2: Infected; T3: Infected + 0.5 kg/ton; T4: Infected + 1 kg/ton; T5: Infected + 2 kg/ton; T6: Infected + DPEP; T7: Infected + 0.4 kg/ton; LABs: Lactic acid bacteria.

Table 12. Ileum morphology and goblet cell count in the differently-treated chickens.

Treatments	Villus height, µm	Villus width, µm	Crypt depth, µm	V:C ratio	Goblet cells, n*
T1	747^d	135^cd	166^bc	4.5^c	12.9
T2	732^d	129^d	189^a	3.9^d	10.6
T3	789^c	130^d	177^b	4.5^c	11.7
T4	799^c	133^d	173^bc	4.6^c	13.6
T5	855^b	147^b	158^cd	5.4^b	13.2
T6	944^a	157^a	155^cd	6.1^a	13.3
T7	788^c	138^c	149^d	5.3^b	12.6
SEM	19.67	2.76	5.91	0.24	0.62
p-Value	0.03	0.04	0.04	0.04	0.03

The means with different letters in the same column are significantly different (p < .05).

n = 20 per treatment; Villus height: Crypt depth (V:C); (n/100 µm of villus height).

T1: Uninfected; T2: Infected; T3: Infected + 0.5 kg/ton; T4: Infected + 1 kg/ton; T5: Infected + 2 kg/ton; T6: Infected + DPEP; T7: Infected + 0.4 kg/ton.

*In 300 µm of villus height.

Teshfam M, Brujeni GN, Hassanpour H. 2006. Evaluation of endothelial and inducible nitric oxide synthase mRNA expression in the lung of broiler chickens with developmental pulmonary hypertension due to cold stress. Br Poult Sci. 47(2):223–229.

 PubMed Web of Science ®Google Scholar

Chen J, Tellez G, Richards JD, Escobar J. 2015. Identification of potential biomarkers for gut barrier failure in broiler chickens. Front Vet Sci. 2:14.

 PubMed Web of Science ®Google Scholar

Tang D, Wu J, Jiao H, Wang X, Zhao J, Lin H. 2019. The development of antioxidant system in the intestinal tract of broiler chickens. Poult Sci. 98(2):664–678.

 PubMed Web of Science ®Google Scholar

Rezaei S, Faseleh Jahromi M, Liang JB, Zulkifli I, Farjam AS, Laudadio V, Tufarelli V. 2015. Effect of oligosaccharides extract from palm kernel expeller on growth performance, gut microbiota and immune response in broiler chickens. Poultr Sci. 94(10):2414–2420.

 PubMed Web of Science ®Google Scholar