Component and microbial community structure change of Huangjiu undergoing rancidification during pottery jar storage

Figures & data

Table 1. Gradient elution procedure for HPLC.

Time/min	0	2	10	12	19	21	31	33	36	38	45
Mobile phase A	92	92	90	81	74	65	54	0	0	92	92
Mobile phase B	8	8	10	19	26	35	46	100	100	8	8

Table 2. Gradient elution procedure for HPLC.

Time/min	0	9	23	32	37	38	47
Mobile phase A	50	63	65	100	100	50	50
Mobile phase B	50	37	35	0	0	50	50

Table 3. Gradient elution procedure for HPLC.

Time/min	0	11	16	20	35
Mobile phase A	0	0	50	0	0
Mobile phase B	100	100	0	100	100
Mobile phase C	0	0	50	0	0

Table 4. The primer names and corresponding sequences.

Thallus	Name of primers	Primer sequences (5‘~3’)
Bacteria	K16S02-65F	TCGTCATACGCTCTAGAGAGTTTGATCMTGGCTCAG
	K16S02-65 R	CTAGAGCGTATGACGAACCTTGTTACGACTT
Fungi	K18SITS202-65F	TCGTCATACGCTCTAGGTAGTCATATGCTTGTCTC
	K18SITS202-65 R	CTAGAGCGTATGACGATCCTCCGCTTATTGATATGC

Table 5. Physicochemical indexes of 3-year-old Huangjiu.

Samples	Alcoholic content/% vol	Total acid content/g˙L^−1	Amino acid nitrogen/g˙L^−1	pH	Conductivity/μS˙cm^−1
Normal	18.4 ± 0.3	4.4 ± 0.3	0.69 ± 0.04	4.2 ± 0.2	1118 ± 56
Mild rancidification J-13	18.1 ± 0.2	5.8 ± 0.3	0.72 ± 0.04	4.0 ± 0.3	1766 ± 86
Severe rancidification J-10	17.2 ± 0.2	15.0 ± 0.5	0.78 ± 0.05	3.7 ± 0.2	2684 ± 124

(a) Normal indicates that the change range of total acid before and after storage is less than 0.5 g/L. (b) Mild rancidification indicates that the total acid after storage is less than 7 g/L, but the increase is more than 0.5 g/L. (c) Severe rancidification indicates that the total acid is higher than 7 g/L after storage. The mean and standard deviation of three independent experiments are shown.

Figure 1. Comparison of organic acid composition during different degree of rancidification.

Figure 2. Comparison of amino acid compositions during different degree of rancidification.

Figure 3. Comparison of bioamine compositions during different degree of rancidification.

Table 6. α diversity indexes of bacteria and fungi.

Flora	Samples	Observed_otus	Shannon	Simpson	Chao1	Ace	Goods_coverage
Bacteria	J-13	35	0.254	0.044	85	86.003	0.990
	J-10	87	3.000	0.668	165.4	186.965	0.951
Fungi	J-13	10	2.259	0.666	11.000	12.491	0.953
	J-10	14	2.978	0.829	28.000	35.030	0.862

Figure 4. Bacterial abundance distribution curve.

Figure 5. Fungal abundance distribution curves.

Figure 6. Composition and relative abundance of bacterial at species level among different rancidity Huangjiu samples.

Figure 7. T-test diagram of bacterial community among different rancidity Huangjiu samples.

Figure 8. Composition and relative abundance of fungal at species level among different rancidity Huangjiu samples.

Figure 9. T-test diagram of fungal community among different rancidity Huangjiu samples.