Quantification of adulterated fox-derived components in meat products by drop digital polymerase chain reaction

Figures & data

Table 1. The list of primers and probes.

Primer/probe	Sequence/labeling(5’→3’)
Fox F	GATGATGCCAGGAAAAGAGGCATT
Fox R	TCCAGGTGGAAAACTGTTTTTTCTCA
Fox Probe	FAM-TGCTGGCAGCATCAGGGACAATCCC -BHQ1

Table 2. ddPCR reaction system.

Component	Volume/μl
ddPCR^TM Supermix for probes	10
Primer-F	1.2
Primer-R	1.2
Probe	0.4
DNA	4
ddH2O	3.2

Figure 1. The specificity detections of the fox primer-probe system.

The specificity of fox primer-probe was tested using the following samples: 1–2 fox, 3–4 beef, 5–6 sheep, 7–8 pork, 9–10 chicken, 11–12 duck, 13 negative.

Figure 2. Linear relationship between meat weight and nucleic acid content of fox.

Table 3. The DNA concentration extracted at different sample qualities.

Number	Sample quality(mg)	DNA concentration(ng/μL)			Average value(ng/μL)	Coefficient of variation (%)
1	5	65.2	64.9	63.2	64.4 ± 1.1	1.7
2	10	124.5	136.1	140.8	133.8 ± 8.4	6.3
3	20	409.2	396.1	412.1	405.8 ± 8.5	2.1
4	30	734.2	742.5	752.7	743.1 ± 9.3	1.2
5	40	1107.4	1112.9	1101.6	1107.3 ± 5.7	0.5
6	50	1294.6	1320.5	1295.7	1303.6 ± 14.6	1.1
7	60	1610.7	1607.2	1627.1	1615.0 ± 10.6	0.7
8	70	1911.7	1889.5	1907.9	1903.0 ± 11.9	0.6
9	80	2202.6	2227.4	2212.3	2214.1 ± 12.5	0.6
10	90	2473.2	2501.3	2470.4	2481.6 ± 17.1	0.9
11	100	2733.6	2751.4	2759.7	2748.2 ± 13.3	0.5

Average values are provided as mean±standard deviation.

Figure 3. The relationship between the DNA content and the copy number of fox samples.

Figure 4. DNA content gradient map of fox.

Table 4. The copy number measured at different DNA concentrations by ddPCR.

Number	DNA content (ng)	Copy Number (copies/μL)			Average value(copies/μL)	Coefficient of variation (%)
1	20	121	114	111	115.3 ± 5.1	4.4
2	40	233	229	218	226.7 ± 7.8	3.4
3	80	453	449	467	456.3 ± 9.5	2.1
4	120	646	671	657	658.0 ± 12.6	1.9
5	160	896	881	907	894.7 ± 13.1	1.5
6	200	1066	1095	1069	1076.7 ± 16.0	1.5
7	240	1296	1271	1299	1288.7 ± 15.4	1.2
8	280	1488	1490	1508	1495.3 ± 11.0	0.7
9	320	1749	1734	1735	1739.3 ± 8.4	0.5
10	360	1921	1906	1915	1914.0 ± 7.5	0.4
11	400	2104	2071	2084	2086.3 ± 16.6	0.8

Average values are provided as mean±standard deviation.

Table 5. Establishment of the fox meat dose response curve.

Linear curve formula	R^2
CDNA = 28.914 M–120.7	R^2 = 0.9986
C = 5.2354TDNA +29.879	R^2 = 0.9992
TDNA=CDNA*V/D
M = 0.05C + 2.7

C_DNA = DNA concentration, C = Copy numbers, T_DNA = total fox DNA, M = fox mass, V = the DNA volume of the reaction system (4 μl), D = the sample dilution ratio(30).

Figure 5. Map of adulterated fox.

Table 6. Adulteration ratios of mixed samples detected by ddPCR.

Number	Fox mass (mg)	DNA copy number (copies/ μL)			Average value (copies/μL)	Coefficient of variation (%)	Measured fox mass(mg)	Relative error (%)
1	10	139	144	147	143 ± 4.0	2.8	9.9	−1.3
2	20	358	379	371	369 ± 10.6	2.9	21.1	5.8
3	30	532	521	526	526 ± 5.5	1.1	29.0	−3.3
4	40	749	743	738	743 ± 5.5	0.7	39.9	−0.3
5	50	955	981	970	969 ± 13.0	1.4	51.1	2.3
6	60	1137	1119	1125	1127 ± 9.2	0.8	59.1	−1.6
7	70	1335	1309	1327	1324 ± 13.3	1.0	68.9	−1.6
8	80	1569	1547	1552	1556 ± 11.5	0.7	80.5	0.6
9	90	1744	1730	1728	1734 ± 8.7	0.5	89.4	−0.7
10	100	1956	1980	1964	1967 ± 12.2	0.6	101.0	1.0

Average values are provided as mean±standard deviation.

Data availability statement

The data supporting the findings of this study are available within the article.