Probiotics alter biofilm formation and the transcription of Porphyromonas gingivalis virulence-associated genes

Figures & data

Table 1. Oligonucleotides primers for real-time PCR assays used for bacteria quantification in biofilms and for transcription analysis of P. gingivalis virulence-associated genes.

Target Gene	Primer sequence (5ʹ-3ʹ)	Reference
16SrRNA
P. gingivalis	TGTAGATGACTGATGGTGAAAACC ACGTCATCCCCACCTTCCTC	[60]
Lactobacillus	AGCAGTAGGGAATCTTCCA CACCGCTACACATGGAG	[61]
Bifidobacterium	TCGCGTC(C/T)GGTGTGAAAG CCACATCCAGC(A/G)TCCAC	[61]
S. oralis	CCGCATAAGAGTAGATGTTG TATGTATCGTTGCCTTGGT	[62]
S. gordonii	GCTTGCTACACCATAGACT CCGTTACCTCACCTACTAG	[62]
P. gingivalis virulence
mfa1	ATCTTCAGCACTCTCCACAAG TTGTTGGGACTTGCTGCTCTTG	[63]
kgp	GCTTGATGCTCCGACTACTC GCACAGCAATCAACTTCCTAAC	[21]
rgp	CCGAGCACGAAAACCAA GGGGCATCGCTGACTG	[21]
luxS	GAGAGGTGGTTACGACTTTC GTAATCGCCTCGCATCAG	[21]
ftsH	CGTCGCAGCATCGCCATCC CAGAGCCTCCGTTGTCGTGATC	[48]
fimA	TTGTTGGGACTTGCTGCTCTTG TTCGGCTGATTTGATGGCTTCC	[63]

Figure 1. Effect of probiotics cell-free supernatants (CFS) diluted at 1:2.5 on P. gingivalis W83 (a1, mono-species; a2, multi-species) and ATCC 33277 (b1, mono-species; b2, multi-species) biofilm biomass, represented by the OD_490nm of the standard biofilm dye. Groups: Neg. control- Negative control represents non-inoculated medium; Control- CFS-free positive controls of P. gingivalis mono- and multi-species biofilms (So – S. oralis and Sg – S. gordonii), and experimental group with CFS of: LA5 – L. acidophilus LA5, HN001 – L. rhamnosus HN001, DSM – L. reuteri DSM 17938, 1101A – B. breve 110^1A, 1191A – B. pseudolongum 119^1A and 1622A – B. bifidum 162^2A. Experiments were conducted in triplicate. (*) Statistically significant difference when compared to respective positive controls using One-way ANOVA with post hoc Tukey’s multiple comparisons (p < 0.05).

Figure 2. Effect of probiotics cell-free supernatants (CFS of LA5 – L. acidophilus LA5, HN001 – L. rhamnosus HN001, DSM – L. reuteri DSM 17938, 1101A – B. breve 110^1A, 1191A – B. pseudolongum 119^1A and 1622A – B. bifidum 162^2A) on the relative abundance of P. gingivalis W83 (a) or ATCC 33277 (b) and the initial colonizers S. oralis and S. gordonii in multi-species biofilms, represented as the mean percentage of each bacteria determined by qPCR. (*) Significant difference in P. gingivalis counts when compared to respective positive controls using One-way ANOVA with post hoc Tukey’s multiple comparisons (p < 0.05).

Figure 3. Effect of living Lactobacillus sp (L. acidophilus LA5, L. rhamnosus HN001, L. reuteri DSM 17938) and Bifidobacterium sp (B. breve 110^1A, B. pseudolongum 119^1A and B. bifidum 162^2A) on the relative abundance of P. gingivalis W83 (a) or ATCC 33277 (b) and the initial colonizers S. oralis and S. gordonii after cell-to-cell interaction, represented as the mean percentage of each bacteria determined by qPCR (*). Significant difference in P. gingivalis abundance, when compared to respective positive controls using One-way ANOVA with post hoc Tukey’s multiple comparisons (p <0.05).

Figure 4. Effect of probiotics on the relative transcription of P. gingivalis encoding virulence genes (mfa1 – minor fimbriae; fimA – major fimbriae; kgp – lysine gingipain; rgpA – arginine gingipain; ftsH – metalloproteinase, and luxS – quorum sensing components), determined by RT-qPCR. P. gingivalis strains W83 and ATCC 33277 biofilms formed in BHIHM broth added with the supernatant of cultures of probiotics (a1 and a2 - L. acidophilus LA5, b1 and b2 – L. rhamnosus HN001, c1 and c2 – L. reuteri DSM 17938, d1 and d2 – B. breve 110^1A, e1 and e2 – B. pseudolongum 119^1A and f1 and f2 – B. bifidum 162^2A) diluted to 1:2.5, in mono-species (a1, b1, c1, d1, 1 and f1) and multi-species (a2, b2, c2, d2, e2 and f2), and infecting OBA-9 GECs with probiotic co-infection at a MOI of 1:1,000 (a3 - L. acidophilus LA5, b3 – L. rhamnosus HN001, c3 – L. reuteri DSM 17938, d3 – B. breve 110^1A, e3 – B. pseudolongum 119^1A and f3 – B. bifidum 162^2A). Data are expressed as fold changes in relation to positive control conditions (biofilms without probiotic cell-free supernatants or GECs without probiotic bacteria), after normalization to the endogenous control gene 16SrRNA. (*) Significant difference when compared to respective positive controls using One-way ANOVA with post hoc Tukey’s multiple comparisons (p < 0.05).

Figure 4. (Continued).

Amano A, Nakagawa I, Kataoka K, et al. Distribution of Porphyromonas gingivalis strains with fimA genotypes in periodontitis patients. J Clin Microbiol. 1999;37(5):1426–1430.

 Web of Science ®Google Scholar

Rinttilä T, Kassinen A, Malinen E, et al. Development of an extensive set of 16S rDNA-targeted primers for quantification of pathogenic and indigenous bacteria in faecal samples by real-time PCR. J Appl Microbiol. 2004;97(6):1166–1177.

 PubMed Web of Science ®Google Scholar

Zhou Y, Yang J, Zhang L, et al. Differential utilization of basic proline-rich glycoproteins during growth of oral bacteria in saliva. Appl Environ Microbiol. 2016;82(17):5249–5258.

 Web of Science ®Google Scholar

Capestany CA, Tribble GD, Maeda K, et al. Role of the Clp system in stress tolerance, biofilm formation, and intracellular invasion in Porphyromonas gingivalis. J Bacteriol. 2008;190(4):1436–1446.

 Web of Science ®Google Scholar

James CE, Hasegawa Y, Park Y, et al. LuxS involvement in the regulation of genes coding for hemin and iron acquisition systems in Porphyromonas gingivalis. Infect Immun. 2006;74(7):3834–3844.

 Web of Science ®Google Scholar

Simionato MR, Tucker CM, Kuboniwa M, et al. Porphyromonas gingivalis genes involved in community development with Streptococcus gordonii. Infect Immun. 2006;74(11):6419–6428.

 PubMed Web of Science ®Google Scholar