Development of a TaqMan-probe-based multiplex real-time PCR for the simultaneous detection of emerging and reemerging swine coronaviruses

Figures & data

Table 1. Primers and probes*.

Pathogens	Primers and Probes	Sequences (5ʹ end to 3ʹ end)	Length (bp)	Gene	Position
PEDV	PE-Detection(F)	CTCCCTTGAATTTGAGTTCG	85	ORF1a	3041–3125^b
	PE-Detection(R)	ACCACCTGTAACCTTGATAC
	PE-Detection(Probe)	FAM-TTACCAACAGCCTTATTAAGCAC-MGB
PDCoV	PD-Detection(F)	AAAGCTTTCAAGACAATACCT	87	ORF1b	15,130–15,216^c
	PD-Detection(R)	TACGACAAACTCCTGAAAGCA
	PD-Detection(Probe)	Texas Red-TACGATACGACTGCATTGGCCTAC-BHQ2
PToV	PT-Detection(F)	TCATCCACCCAGTTCAAAT	73	ORF1a	1024–1096^d
	PT-Detection(R)	TGCACAATTCTCTCTCCAAAT
	PT-Detection(Probe)	VIC-CCTCAG^aTTTCG^aAGATAG^aACC-BHQ1
SADS-CoV	SA-Detection(F)	CATTTGCCGTTCTTGACCAT	95	ORF1a	5269–5363^e
	SA-Detection(R)	AACCCAGCAATTGTTATCTGAA
	SA-Detection(Probe)	Cy5-CAAGTGCACGCTTACCATCAACTACT-BHQ3

^aLNA, Locked Nucleic Acid.

^bGenBank accession No. AF353511.1.

^cGenBank accession No. JQ065042.2.

^dGenBank accession No. NC_022787.1.

^eGenBank accession No. MF167434.1.

*All primers and probes are protected by patent. For any commercial use please contact the corresponding author.

Figure 1. Preparation of plasmid standards. A-D: amplification curves (X-axis: Cycle, Y-axis: Fluorescence) of PEDV, PDCoV, PToV, and SADS-CoV for each plasmid standard of concentrations with 1 × 10⁷ copies/μL to 1 × 10¹ copies/μL; E-H: standard curves of plasmid standards of PEDV, PDCoV, PToV, and SADS-CoV. All standard curves were conducted with software GraphPad Prism 8.

Table 2. Cq values of PEDV, PDCoV, PToV, and SADS-CoV detected by this multiplex real-time PCR assay with different probe and primer concentrations.

PEDV					PDCoV
Probe concentration (nM)	Primer concentration (nM)				Probe concentration (nM)	Primer concentration (nM)
	1200	1600	2000	2400		1200	1600	2000	2400
200	31.14	29.75	29.46	29.58	200	30.97	29.07	28.54	28.29
400	30.50	29.49	28.47	29.40	400	30.20	28.60	27.36	28.09
600	29.78	29.19	29.04	29.02	600	29.73	28.31	28.01	27.92
800	29.43	29.18	28.91	28.91	800	29.14	28.21	27.90	27.93
1000	29.55	29.08	29.11	28.84	1000	28.42	27.94	28.13	27.83
PToV					SADS-CoV
Probe concentration (nM)	Primer concentration (nM)				Probe concentration (nM)	Primer concentration (nM)
	1200	1600	2000	2400		1200	1600	2000	2400
200	31.63	29.35	29.48	29.24	200	29.82	29.10	29.08	28.99
400	30.87	29.57	28.04	28.77	400	30.56	29.51	29.26	29.35
600	30.17	29.05	28.81	28.72	600	31.47	29.77	29.68	29.51
800	29.49	28.73	28.65	28.40	800	31.66	30.14	29.42	29.59
1000	28.57	28.40	28.17	28.05	1000	33.66	30.58	30.21	29.96

Figure 2. A-D: amplification curves (X-axis: Cycle, Y-axis: Fluorescence) of PEDV, PDCoV, PToV, and SADS-CoV detected by multiplex real-time PCR with different probe and primer concentrations. Plasmid standards with concentration of 1 × 10³ copies/μL were chosen as templates for the reactions. The four green lines are the amplification curves of four fluorescence of the most suitable reaction tube.

Table 3. Sensitivity of the multiplex real-time PCR assay.

Pathogens	Concentration	Total	Positive	Detection rate	95% detection rate
PEDV	1000 copies/μL	23	23	100.0%	> 95%
	100 copies/μL	23	23	100.0%	> 95%
	10 copies/μL	23	20	87.0%	< 95%
PDCoV	1000 copies/μL	23	23	100.0%	> 95%
	100 copies/μL	23	23	100.0%	> 95%
	10 copies/μL	23	14	60.9%	< 95%
PToV	1000 copies/μL	23	23	100.0%	> 95%
	100 copies/μL	23	23	100.0%	> 95%
	10 copies/μL	23	17	73.9%	< 95%
SADS-CoV	1000 copies/μL	23	23	100.0%	> 95%
	100 copies/μL	23	23	100.0%	> 95%
	10 copies/μL	23	12	52.2%	< 95%

The cutoff line of positivity is automatically decided by Roche LightCycler® 96 Instrument.

Figure 3. A: amplification curves (X-axis: Cycle, Y-axis: Fluorescence) of 10-fold serial dilutions (1 × 10⁷–1 × 10¹ copies/μL) of plasmid standards of PEDV, PDCoV, PToV, and SADS-CoV detected by multiplex real-time PCR. B: four amplification curves represent samples positive for PEDV, PDCoV, PToV, and SADS-CoV detected by our multiplex real-time PCR assay; negative samples include TGEV, PoRV, PSV, PTV, CSFV, PKV, and negative control.

Figure 4. Co-infection simulation experiments with two pathogens. A-F: amplification curves (X-axis: Cycle, Y-axis: Fluorescence) of PDCoV + SADS-CoV, PDCoV + PToV, PEDV + SADS-CoV, PEDV + PDCoV, PEDV + PToV, PToV + SADS-CoV at concentrations of 1 × 10³ copies/μL; G-L: amplification curves of PDCoV + SADS-CoV, PDCoV + PToV, PEDV + SADS-CoV, PEDV + PDCoV, PEDV + PToV, PToV + SADS-CoV at concentrations of 1 × 10² copies/μL. Two replicates were set per reaction.

Figure 5. Co-infection simulation experiments with three pathogens. A-D: amplification curves (X-axis: Cycle, Y-axis: Fluorescence) of PDCoV + PToV + SADS-CoV, PEDV + PToV + SADS-CoV, PEDV + PDCoV + SADS-CoV, PEDV + PDCoV + PToV with concentration of 1 × 10³ copies/μL; E-H: amplification curves of PDCoV + PToV + SADS-CoV, PEDV + PToV + SADS-CoV, PEDV + PDCoV + SADS-CoV, PEDV + PDCoV + PToV with concentrations of 1 × 10² copies/μL. Two replicates were set per reaction.

Figure 6. Co-infection simulation experiments with four pathogens. A-B: amplification curves (X-axis: Cycle, Y-axis: Fluorescence) of PEDV + PDCoV + PToV + SADS-CoV at concentrations of 1 × 10² copies/μL and 1 × 10⁷ copies/μL. Two replicates were set per reaction.

Figure 7. Co-infection of all the four pathogens at different concentrations. A: the concentration of plasmid standard of PEDV was 1 × 10⁷ copies/μL and the others were 1 × 10² copies/μL; B: the concentration of plasmid standard of PDCoV was 1 × 10⁷ copies/μL and the others were 1 × 10² copies/μL; C: the concentration of plasmid standard of PToV was 1 × 10⁷ copies/μL and the others were 1 × 10² copies/μL; D: the concentration of plasmid standard of SADS-CoV was 1 × 10⁷ copies/μL and the others were 1 × 10² copies/μL. Two replicates were set per reaction. X-axis: Cycle, Y-axis: Fluorescence.