Maltose promotes crucian carp survival against Aeromonas sobrial infection at high temperature

Figures & data

Table 1. Primers used for QRT-PCR analysis.

Gene	Primer	Sequence (5’-3’)
actin	Forward	gggatgggacagaaggacag
	Reverse	acgcagctcgttgtagaagg
gapdh	Forward	tgacccctccagtatgacca
	Reverse	gagggcctcctcaataccaa
tubulin	Forward	ctgctgggaactctattgtc
	Reverse	ctccaggtctacaaacacag
il1b1	Forward	atgcgctgctcaacttcat
	Reverse	ctggcccttattttgttgag
il1b2	Forward	caaagcgatcctcttcattt
	Reverse	attcgggtcatcagttttaa
il11	Forward	ttcgagtggctgaacagaac
	Reverse	aggcccagtcacagaagagc
tnfα1	Forward	tcacgctcaacaagtctcag
	Reverse	tggtcctttctccagtaaag
tnfα2	Forward	ccgctgtctgcttcacatt
	Reverse	ggccttggaagtgacattt
tlr2	Forward	cttagatgggctcactcatc
	Reverse	gggtgggagacatctttaag
tlr3	Forward	tagatgccagctacaactcttt
	Reverse	ggctccccaattaacttcag
tlr9	Forward	gccaacccatgttatcagtc
	Reverse	ggtgtcgcagatttttaaga
nfkbiab	Forward	cagtttggcgcagacatt
	Reverse	gcgcctttgctgattagaag
ifnγ1-1	Forward	ctacgggtcctgaaagactt
	Reverse	gcctgggaagtagttttctc
ifnγ1-2	Forward	tctggggagtatgcttgttga
	Reverse	gcctgggaagtagttttcttg
c3	Forward	tggggatggatctgaaaca
	Reverse	tgcccatgatgaggtacga
lyz	Forward	tgtgtctgatgtggctgtgc
	Reverse	tgcacacatagttgccaagtga

Figure 1. Percent survival of crucian carp to A.sobrial infection at 18°C and 33°C. Crucian carp were acclimated at 18°C or 33°C for 7 days and then were challenged with saline or A.sobrial (1 × 10⁶CFU/dose; n = 30 for each treatment). The percent survival was monitored for 15 days.

Figure 2. Crucian carp had different metabolomics profiling when cultured at different temperatures.

(a) Categories of the differential metabolites. (b) The number of differential abundance of metabolites in each category. Blue or orange indicates a decrease or increase in the abundance of metabolites, respectively. (c) Heat map of unsupervised hierarchical clustering of differential metabolites (row). Yellow and blue indicate the increase and decrease of the metabolites scaled to mean and standard deviation of row metabolite level, respectively (see color scale). (d) Z scores (standard deviation from average) of 33°C-group to 18°C-group which are corresponding to the data shown in (c). Each point represents one technical repeat of metabolite.

Figure 3. Pathway analysis of differential metabolites.

(a) Pathway enrichment analysis of differential metabolites. Significantly enriched pathways are selected to plot (p value<0.05), and their impact was indicated. (b) The relative abundance of metabolites of each pathway listed in (a). Metabolites highlighted with yellow and blue indicate the increased and decreased abundance, respectively.

Figure 4. Metabolic network of the metabolites with differential abundance, and measurement of the activities of enzymes of the TCA cycle.

(a) Integrated metabolic network in relation to differential metabolites by iPath. The red and blue are depicted the increased and decreased metabolites in 33°C-group, respectively (b) The enzymatic activity of PDH, α-KGDH, SDH, and MDH of spleens isolated from crucian carp grown at 33°C and 18°C. Values are means ±SEM from 6 biological replicates as analyzed by Kruskal–Wallis followed by Dunn’s multiple comparison post hoc test. * p < 0.05; ** p < 0.01

Figure 5. Maltose promotes fish survival against A. sobrial infection.

(a) The PCA analysis of metabolomic profiling of sample from fish grown at 33°C and 18°C. Each dot represents the technique replicates in the plot. (b) S-plot, generated by OPLS-DA, to identify differential metabolites of intragroup as from t [1] in (a). Each triangle represents individual metabolite, where potential biomarkers are highlighted with red, which is greater or equal to 0.05 and 0.5 for the absolute value of covariance p and correlation p (corr), respectively. (c) Maltose is a crucial biomarker that distinguishes the 33°C and 18°C as shown with dot-blot.

Figure 6. Maltose promotes fish survival against A.sobrial infection.

Percent survival of crucian carps in the presence of maltose. Crucian carp were treated with saline or different doses of maltose at 33°C for 3 days, followed by bacterial challenge through intraperitoneal injection (1 × 10⁶ CFU). The accumulative fish death was monitored for a total of 15 days post-infection (n = 30 per group).

Figure 7. Maltose does not promote the activity of TCA cycle.

The enzymatic activity of PDH, α-KGDH, SDH, and MDH of spleens isolated from crucian carp after administration of maltose (n = 6; 600 μg) at 33°C. Values are means ±SEM from 6 biological replicates as analyzed by Kruskal–Wallis followed by Dunn’s multiple comparison post hoc test. * p < 0.05; ** p < 0.01

Figure 8. Maltose modulates innate immune response at 33°C.

qRT-PCR for cytokine genes of crucian carp treated with saline or maltose (600 μg) for 3 days following with A.sobrial challenge through intraperitoneal injection (1 × 10⁴ CFU). Values are means ±SEM from six biological replicates. * p < 0.05; ** p < 0.01.

Hawkes C. Global nutrition report 2017: Nourishing the SDGs. Development Initiatives; 2017.

 Google Scholar