Prevalence and analysis of acquired and transmitted integrase strand transfer inhibitor-associated HIV-1 drug resistance in Chongqing, China

Figures & data

Table 1. Primers for amplification and sequence analysis of HIV-1 integrase (IN) region.

Procedure	Primers	Position^a	Length of target fragment	Sequences (5”−3”)
First round	4007F	4007–4030	1213	GCAGGATTCRGGATYAGAAGTAAA
	5219 R	5219–5243		CCTAGTGGGATGTGTACTTCTGAAC
Second round	4063F	4063–4080	1157	TCATTCARGCACAACCAG
	5219 R	5219–5243		CCTAGTGGGATGTGTACTTCTGAAC

^aNucleotide positions with reference to HIV H×B2 strain (GenBank accession number:K03455).

Figure 1. Flow chart of our study.(INSTI integrase strand transfer inhibitor;ART antiretroviral therapy;DR drug resistance).

Table 2. Baseline demographic and viral characteristics.

Characteristic	Patients (1032)
sex
Male-no.(%)	818 (79.26%)
Female-no.(%)	214 (2.73%)
Age at diagnosis (years)
Male (Median/rang)	50/(12–89)
Female (Median/rang)	54/(14–80)
Race/ethnicity
Han nationality-no.(%)	98.16%
other-no.(%)	1.84%
Transmission route
MSM-no.	91
HSX-no.	926
MTCT-no.	5
BT-no.	3
OTH-no.	7
CD4+Tcell count (cell/µl)
CD4+, Median (min/max)	185 (4/2183)
HIV baseline viral load (copies/ml plasma)
VL, Median (min/max)	3630 (1006/2210000)

MSM,men who have sex with other men;HSX,heterosexual orientation;BT,blood transfusion;MTCT,mother-to-child transmission;OTH,others including patients who are unknown or unwilling to explain why.

Table 3. INSTI-associated mutation in ART-treated and naive patients.

NO	Treatment status	subtype	INI DRMs	INSTI DR	DR level
				(Yes or No)	BIC	CAB	DTG	EVG	RAL
H1718	ART-treated*	A	G118R, E138K	Yes	H	H	H	H	H
H3141	ART-treated*	CRF07_BC	G118R	Yes	I	H	I	H	H
H3222	ART-treated*	CRF01_AE	E138K, Q148R	Yes	I	H	I	H	H
H3740	ART-treated*	CRF01_AE	G118GR	Yes	I	H	I	H	H
H3807	ART-treated	CRF08_BC	S230R	Yes	P	L	L	L	L
H3817	ART-naive	CRF07_BC	S230R	Yes	P	L	L	L	L
H3872	ART-naive	CRF08_BC	S230R	Yes	P	L	L	L	L
H3905	ART-naive	CRF08_BC	S230R	Yes	P	L	L	L	L
H3944	ART-treated*	CRF01_AE	E138K, S147G, Q148R, R263K	Yes	H	H	H	H	H
H4034	ART-treated	CRF07_BC	E92Q	Yes	P	L	P	H	I
H4051	ART-treated	CRF08_BC	N155S	Yes		L		I	I
H4117	ART-naive	CRF08_BC	S230R	Yes	P	L	L	L	L
H4122	ART-treated	CRF08_BC	S230R	Yes	P	L	L	L	L
H4275	ART-treated*	CRF01_AE	Q148R	Yes	L	I	L	H	H
H4281	ART-treated*	CRF01_AE	S147G, Q148R	Yes	I	H	I	H	H
H4333	ART-treated	CRF07_BC	G140K, G163R	Yes				L	L
H4430	ART-treated*	CRF07_BC	G118KR, H51Y	Yes	I	H	H	H	H
H4487	ART-treated*	B	N155H	Yes	P	L	P	H	H
H4494	ART-treated*	CRF07_BC	E92Q,T97A	Yes	P	L	P	H	I
H4559	ART-treated*	CRF55_01B	E92Q	Yes	P	L	P	H	I
H4778	ART-treated*	CRF08_BC	E138K,S147G,Q148R,A128T	Yes	H	H	H	H	H

CRF circulating recombinant forms; DR drug resistance; BIC bictegravir; CAB cabotegravir;DTG dolutegravir; EVG elvitegravir; RAL raltegravir; DRMs: drug resistance mutations; P (potential low-level drug resistance), L (low-level drug resistance), I (intermediate drug resistance), H (high-level drug resistance); ART: antiretroviral therapy; INSTIs: integrase strand transfer inhibitors; ART-exposed*, ART included INSTIs.

Table 4. Analysis of INSTI drug resistance mutations.

Drug category	Drugs	DR(No.)				DRMs*
		Low	Medium	High	Total
INSTI	BIC	1	5	3	9	Q148R,R263K,G118R
	CAB	11	1	8	20	Q148R,R263K,E92Q,G118R,N155H,H51Y,S230R
	DTG	7	4	4	15	Q148R,R263K,G118R,S230R
	EVG	7	1	13	21	E138K/A,E157Q,Q148R,S147G,R263K,E92Q,G118R,N155H,H51Y,S230R
	RAL	7	4	10	21	E138K/A,Q148R,R263K,E92Q,G118R,N155H,H51Y,S230R,E157Q

INSTI integrase strand transfer inhibitors;DR drug resistance mutations;BIC bictegravir;CAB cabotegravir;DTG dolutegravir; EVG elvitegravir; RAL raltegravir.

*Only DRMs reduced drugs susceptibility alone are listed.

Table 5. Prevalence of drug-specific INSTI mutation in ART-treated and naive patients.

Major drug resistance			Minor drug resistance
mutation	Prevalence n(%)		mutation	Prevalence n(%)
	P^a	P-naive^b		P^a (total)	P-naive^b
E138K	4(0.39)	1(0.18)	A128AT	8(0.78)	3(0.53)
S147G	3(0.29)	0	E157Q	17(1.65)	10(1.77)
Q148R	5(0.48)	0	T97A	2(0.19)	1(0.17)
E92Q	3(0.29)	0	H51Y	1(0.09)	0
G118R	4(0.39)	0	G140K	1(0.09)	0
N155H	1(0.09)	0	G163R	1(0.09)	0
N155S	1(0.09)	0	Q95K	2(0.19)	2(0.35)
R263K	1(0.09)	0	S230R	6(0.58)	4(0.71)

DRMs drug resistance mutations;INSTI integrase strand transfer inhibitors.

^aPopulation prevalence of drug resistance mutations.

^bPrevalence of drug resistance mutations in ART-naïve HIV patients.

Figure 2. A phylogenetic analysis of the in gene.

Table 6. Distribution and prevalence of INSTI DR among HIV-1 subtype.

subtype	patients n(%)	DR n(%)	ART-naive n(%)	ART-naive DR n(%)
A	4(.39)	1(25.00)	1(0.18)	0(0)
B	12(1.16)	1(8.33)	6(1.06)	0(0)
C	25(2.42)	0(0)	3(0.53)	2(66.67)
CRF01_AE	205(19.86)	3(1.46)	13(2.30)	2(15.38)
CRF07_BC	595(57.66)	23(3.87)	341(60.46)	12(35.19)
CRF08_BC	147(14.24)	8(5.44)	78(13.83)	3(3.85)
CRF55_01B	25(2.42)	1(4.00)	10(1.77)	0(0)
CRF52_01B	8(.78)	0(0)	2(0.35)	0(0)
CRF59_01B	2(.19)	0(0)	1(0.18)	0(0)
CRF67_01B	1(.09)	0(0)	0(0)	0(0)
CRF77_cpx	1(.09)	0(0)	1(0.18)	0(0)
CRF78_cpx	1(.09)	0(0)	1(0.18)	0(0)
CRF85_BC	6(.58)	0(0)	5(0.89)	0(0)
Total	1032 (100)	37(3.58)	564(54.81)	19(3.37)

CRF circulating recombinant forms;DR drug resistance.

Data Availability statement

The data in this study are available from the first author (HZ.Z) on reasonable request.