HBs antigen and mannose loading on the surface of iron oxide nanoparticles in order to immuno-targeting: fabrication, characterization, cellular and humoral immunoassay

Figures & data

Table 1. The primer sequences of target genes.

Target genes	Primer sequence (5'–3')	References
TNF-α	CGGTGGTGGGACTCGTATG GCTGGTTGTCTTCCAGCTTCA	[36]
IL-10	CTTGTCGGAAATGATCCAGTTTT TTCACGTGCTCCTTGATGTCA	[37]
IL-6	GTCTTCAAACGAGTGGGTAAAG TGACCAGAGGAGGGAATGC	[36]
TGF-β	TGGCGTTACC TTGGTAACC GGTGTTGAGCCCTTTCCAG	[38]
IFN-γ	TAGGCAAGTCTATGGGATTTC GCATTCATTACATCATCAAGTG	[36]
β-actin	F TCCTCCTGAGCGCAAGTAC R CCTGCTTGCTGATCCACATCT	[39]

Table 2. Experimental groups with vaccine formulations.

Groups	Vaccine formulations	Number
1	MLCMNP + HBsAg	9
2	LCMNP + HBsAg	9
3	commercial HBs vaccine	9
4	HBsAg	9
5	Control MLCMNP	5
6	Control MNP	5
7	Control PBS	5

Figure 1. FTIR spectra MNP nanoparticles (a), MNP–silica-coated nanoparticles (b), LCMNP (c), MLCMNP (d), l-cysteine (e) and mannose (f).

Figure 2. XRD patterns of LCMNP and MLCMNP.

Figure 3. SEM images of (a) LCMNP, (b) MLCMNP and (c) MLCMNP-rHBsAg.

Table 3. Nanoparticles characterization.

Nanoparticle type	Average particle ζ-potential (mV)^a	Sugar density (µg/mg of particle)^b	HBsAg density (µg/mg of particle)
LCMNP	−79.15 ± 0.21	–	–
MLCMNP	−22.85 ± 0.21	26.37 ± 3.99	–
MLCMNP-rHBsAg	−44.5 ± 0.57	21.41 ± 0.07	0.5
MNP-rHBsAg	−54.4 ± 0.71	–	0.5

^a Zeta potential data represent the mean ± SD of two independent experiments.

^b Sugar density data are presented as mean ± SD of two independent experiments.

Figure 4. HBsAg release profile from LCMNP/MLCMNP. The values are expressed as mean ± SD (n = 3).

Figure 5. (A) 5 µg/lane HBsAg; (B) 10 µg/lane HBsAg; (C) 20 µg/lane HBsAg; (D) markers; (E) MNP + HBsAg + mannose precipitate; (F) MNP + HBsAg + mannose supernatant; (G) MNP + HBsAg precipitate; (H) MNP + HBsAg supernatant.

Figure 6. MTT assay against HEK293 cells with different concentrations of HBsAg-loaded MLCMNP (a) and LCMNP (b) nanoparticles. Data are shown as mean ± SD (n = 3).

Figure 7. ICP-OES analysis of the iron contents of the J774 cells incubated with 200 μg/mL of MNP, MNP + mannose, MNP + HBsAg, MNP + mannose + HBsAg and also mere cells was used as a control.

Figure 8. Real-time-PCR quantification of IFN-γ, TNF-α, TGF-β, IL-10 and IL-6 cytokine gene expressions in macrophage/dendritic cells MNP (A), MNP + mannose-stimulated cells (B), MNP + HBsAg-stimulated cells (C), MNP + HBsAg + mannose-stimulated cells (D), and LPS-stimulated cells compared with β-actin gene (E). Expression was monitored over a 12-h period.

Figure 9. Specific total IgG responses after immunization course. Conjugation of nano-vaccine with mannose increased antibody responses versus nano-vaccine without mannose.

Figure 10. Results of IgG2a/IgG1 isotype. The sera 7 days after the last immunization. Conjugation of nano-vaccine with mannose increased IgG2a/IgG1 ratio versus nano-vaccine without mannose. Data are shown as mean ± SD.

Figure 11. Results of lymphocyte proliferation. Experimental mice were immunized with MLCMNP-HBsAg, LCMNP-HBsAg, commercial vaccine, HBs Ag alone and control mice were injected with MNP, MNP + mannose and PBS. Two weeks after last immunization, lymphocyte proliferation was assessed with BrdU method as mentioned in the method section. The results presented as mean ± SD of 10 mice per group. Immunization with MLCMNP-HBsAg and LCMNP-HBsAg significantly increased lymphocyte proliferation versus commercial vaccine, HBs Ag alone and control groups.

Figure 12. Results of IFN-γ cytokine assay. Mice were immunized two times with two weeks’ interval with MLCMNP-HBsAg, LCMNP-HBsAg formulation, commercial vaccine and HBs Ag alone along with proper control groups. Two weeks after last immunization of experimental mice, IFN-γ cytokine level was assessed using commercial quantitative ELISA kit. The results presented as mean ± SD of ten mice per group. Immunization with MLCMNP-HBsAg, LCMNP-HBsAg formulation, commercial vaccine and HBs Ag alone significantly increased IFN-γ cytokine versus control groups.

Figure 13. Results of TNF-α cytokine assay. Data presented as mean ± SD of 10 mice per group. Immunization with MLCMNP-HBsAg significantly increased TNF-α cytokine versus the LCMNP-HBsAg group.

Figure 14. Results of IL-2 cytokine assay. After immunization course of experimental mice, IL-2 cytokine level was assessed with a quantitative commercial ELISA kit. Immunization of mice by MLCMNP-HBsAg formulation shows a significant increase of IL-2 cytokine production versus other experimental groups.

Figure 15. Results of IL-4 cytokine assay. After immunization course of experimental mice, IL-4 cytokine level was assessed with a quantitative commercial ELISA kit. The results presented as mean ± SD of 10 mice per group. Immunization with MLCMNP-HBsAg, LCMNP-HBsAg formulation significantly increased IL-4 cytokine secretion versus commercial vaccine, HBs Ag alone and control groups.

Figure 16. Results of IL-12 cytokine assay. The results presented as mean ± SD of 10 mice per group. Immunization of mice with MLCMNP-HBsAg formulation represented a significant increase in IL-12 level versus other experimental groups.

Figure 17. Interaction between LCMNP and mannose sugar.

Table 4. X-ray photoelectron spectroscopy (XPS) analysis of atomic percentages of elements present on LCMNP, MLCMNP, MLCMNP-HBsAg and LCMNP-HBsAg.

Element	LCMNP	MLCMNP	MLCMNP-HBsAg	LCMNP-HBsAg
C	3.44	4.09	4.11	9.89
N	2.48	3.41	3.45	3.69
O	35.29	46.11	43.04	43.30
Si	10.55	10.01	10.41	9.20
S	1.87	1.20	0.96	0.71
Fe	46.36	35.18	38.01	33.21

Figure 18. Magnetization curves for the prepared LCMNP, MLCMNP-HBsAg and LCMNP-HBsAg.

Qadis AQ, Goya S, Yatsu M, et al. Effects of a bacteria-based probiotic on subpopulations of peripheral leukocytes and their cytokine mRNA expression in calves. J Vet Med Sci. 2014;76:189–195.

 PubMed Web of Science ®Google Scholar

Gonzalez DD, Rimondi A, Aguirreburualde MP, et al. Quantitation of cytokine gene expression by real time PCR in bovine milk and colostrum cells from cows immunized with a bovine rotavirus VP6 experimental vaccine. Res Vet Sci. 2013;95:703–708.

 PubMed Web of Science ®Google Scholar

Wickert L, Steinkrüger S, Abiaka M, et al. Quantitative monitoring of the mRNA expression pattern of the TGF-β-isoforms (β1, β2, β3) during transdifferentiation of hepatic stellate cells using a newly developed real-time SYBR Green PCR. Biochem Biophys Res Commun. 2002;295:330–335.

 PubMed Web of Science ®Google Scholar

Fard NN, Noorbazargan H, Mirzaie A, et al. Biogenic synthesis of AgNPs using Artemisia oliveriana extract and their biological activities for an effective treatment of lung cancer. Artif Cells Nanomed Biotechnol. 2018;27:1–12.

 Web of Science ®Google Scholar