Large-scale quantitative genomics analyzes the circRNA expression profile and identifies the key circRNA in regulating cell proliferation during the proliferation phase of rat LR

Figures & data

Table 1. Sequences of the out-facing primers used in this study.

circRNA name	Primer 1	Primer 2	Product length (bp)
circ_03848	AGAGATGCTTCCGAGATACTGT	CTCAAACTTCACTCCAAAATGT	233
circ_08236	GGATATGTACTCCTGGCTAT	GTCCCATTATGTTGTGTTTT	107
circ_13398	GCTCTACCTGCCCAAGTTCT	TGCTTCTGTGCCTGTCTCAT	187
circ_15013	ATTCCTTATTGGTTGTATTG	ACTTTCTGACGGTTGTTCTC	228

Table 2. High-throughput RNA sequencing data of rat liver after PH^a.

Sample	Raw reads	Raw bases	Clean reads	Clean bases	Valid bases	Q30
0 h	120151652	18022747800	88766110	13246257197	73.50%	96.62%
12 h	140496226	21074433900	89508088	13370443971	63.44%	97.32%
24 h	120991372	18148705800	89651032	13385604626	73.76%	97.06%
30 h	103989516	15598427400	85650950	12795423466	82.03%	97.12%
36 h	99480748	14922112200	87354306	13042753802	87.41%	96.90%
72 h	119738438	17960765700	88708104	13246658778	73.75%	97.13%

^aQ30 refers to the percentage of nucleotides with Phred quality score >30.

Figure 1. Expression pattern of circRNAs was detected by high-throughput RNA sequencing during the proliferation phase of rat LR. (A) circRNAs detected at each time point in the proliferation phase of LR. (B) The length distribution of circRNAs. (C) Box plots of RPM value of circRNAs. (D) The category of circRNAs. (E) CircRNA distribution on chromosome/scaffold.

Figure 2. Identification of DE circRNAs in the proliferation phase of LR. (A) Venn analysis of DE circRNAs. (B) Hierarchical cluster analysis and heatmap. (C) The expression situation of DE circRNAs. (D) The distribution of DE circRNAs in different categories.

Figure 3. The circRNA–miRNA–mRNA interaction networks. DE circRNAs (green node), their targeted miRNAs (red node) and genes (blue node, involved in cell proliferation) were predicted based on sequence-pairing prediction. The column size was depended on “Number of Directed Edges”.

Figure 4. Enrichment analysis of indirectly downstream mRNAs for differentially expressed circRNAs. The GO enrichment analysis of cellular component (A), molecular function (B) and biological process (C). (D) The KEGG pathway enrichment analysis.

Figure 5. The circRNA–miRNA–mRNA interaction networks and expression profile of the candidate key circRNAs. (A) The candidate key circRNAs and their targeted miRNAs were displayed by green and red node, respectively. (B) DE RNA expression profile of the ceRNA network during the proliferation phase of rat LR. (C) The candidate key circRNAs, their targeted miRNAs and downstream mRNAs were displayed by green, red and blue node, respectively. The column size was depended on “Number of Directed Edges”.

Figure 6. The relative level of four candidate key circRNAs during the proliferation phase of rat LR. (A) Amplification of circRNAs using outward-facing primers with cDNA but not genomic DNA (gDNA). (B) circ_03848. (C) circ_08236. (D) circ_13398. (E) circ_15013.

qRT-PCR,

high-throughput sequencing. The infinite was represented by 9 and the infinitesimal was represented by 0.3 for the high-throughput sequencing data.