Protective and curative role of Spirulina platensis extracts on cisplatin induce acute kidney injury in rats

Figures & data

Table 1. Primers sequences for Real-Time PCR.

Genes	Forward primer	Reverse primer	Accession no.
Bax	GTGTGGCAGCTGACATGTTT	GATCAGCTCGGGCACTTTAG	NM_017059.2
Sirt1	GATACCTTGGAGCAGGTTGC	CTCCACGAACAGCTTCACAA	NM_017601788.1
GAPDH	ATGACTCTACCCACGGCAAG	TACTCAGCACCAGCATCACC	NM_17008.4

Table 2. Measurements of body and kidney weight for the experimental rats.

Group	Control	Cisplatin	Spirulina	Cisplatin+Spirulina	Spirulina+Cisplatin	p value
Body weight	199.4 ± 6.6^a,c	162.3 ± 12.7^b	205.8 ± 3.6^a,c	172.4 ± 17.5^b	193.2 ± 6.33^a,c	≤0.0001
Kidney weight	1.096 ± 0.04^e	1.45 ± 0.16^f	1.92 ± 0.087^b	1.74 ± 0.047^a,c	1.86 ± 0.052^a,b	≤0.0001
Relative kidney weight	0.006 ± 0.00024^d	0.009 ± 0.0013^a	0.0093 ± 0.0005^a	0.0102 ± 0.0012^a,c	0.0096 ± 0.0005^a	≤0.0001

Different liters mean significant at p < 0.05.

Same liters mean insignificant at p > 0.05.

Table 3. Comparison between studied groups according to kidney function.

Group	Control	Cisplatin	Spirulina	Cisplatin+Spirulina	Spirulina+Cisplatin	p value
creatinine	0.41 ± 0.1^a	1.89 ± 0.27^d	0.38 ± 0.06^a	0.92 ± 0.23^b,c	0.36 ± 0.12^a	≤0.0001
BUN	15.93 ± 1.13^a	44.97 ± 6.04^b	14.76 ± 0.83^a	23.54 ± 2.7^d	15.54 ± 1.7^a	≤0.0001

Different liters mean significant at p < 0.05.

Same liters mean insignificant at p > 0.05.

Table 4. Biochemical investigations among different groups.

Group	Control	Cisplatin	Spirulina	Cisplatin+Spirulina	Spirulina +Cisplatin	P value
KIM	0.2154 ± .04495 ^a	29.1196 ± 1.05^b	0.0990 ± .02567^a	19.9552 ± 0.80^d	1.1909 ± 0.199^a	≤0.0001
NGAL	28.99 ± 1.70^a	244.6 ± 6.6^b	27.4793 ± 1.27^a	161.8 ± 8.3^c	40.7649 ± 1.37^d	≤0.0001
Micro albumin urea	0.2282 ± .031^a	58.75 ± 1.94^b	.1896 ± 0.25^a	36.86 ± 1.91^c	5.9494 ± 0.75^d	≤0.0001

Different liters mean significant at p < 0.05.

Same liters mean insignificant at p > 0.05.

Table 5. Blood counts parameters among different rat groups.

Group	Control	Cisplatin	Spirulina	Cisplatin+Spirulina	Spirulina +Cisplatin	P
WBCs	9.81 ± 0.38^a	7.93 ± 0.47^b	9.34 ± 0.32^a,c	8.73 ± 0.47^c	9.49 ± 0.32^a,c	≤0.0001
Plat.	1345.4 ± 34.14^a	826.8 ± 57.9^b	1390 ± 21.03^a	948.2 ± 21.4^b,c	1188 ± 33.1^a,c	≤0.0001
Hgb	14.03 ± 0.46 ^a	10.05 ± 0.54 ^b	15.01 ± 0.28^c	13.04 ± 0.49^d	14.22 ± 0.38^a	≤0.0001
Hct	45.5 ± 1.8^a	27.1 ± 9.4^b	45.51 ± 0.64^a	42.86 ± 2.06 ^a	42.42 ± 2.39 ^a	≤0.0001
MCV	64.61 ± 1.96^a	47.53 ± 5.03^b	65.06 ± 0.86^a	61.72 ± 1.45^a	60.82 ± 1.24^a	≤0.0001
MCH	20.19 ± 0.57^a	18.36 ± 0.55^b	20.33 ± 0.63^a	20.45 ± 0.68^a	20.60 ± 0.63^a	≤0.0001
MCHC	30.41 ± 1.27^a	29.30 ± 1.27^a	31.9 ± 1.43^a	30.16 ± 0.55^a	30.53 ± 0.72^a	0.003
RBCs	6.52 ± 0.40^a	4.64 ± 0.56^b	6.67 ± 0.40^a	6.33 ± 0.32^a,	6.41 ± 0.43^a	≤0.0001

Different liters mean significant at p < 0.05.

Same liters mean insignificant at p > 0.05.

Figure 1. Control (saline injected) normal rat. Tubules show intact architecture, no intervening fibrosis.

Figure 2. Control (saline injected) normal rat. Tubules of the OSOM show intact architecture, no degenerative or regenerative changes.

Figure 3. Kidney for rats receiving Spirulina. High magnification showing tubules of the OSOM with intact architecture, no degenerative or regenerative changes.

Figure 4. OSOM of rat receiving spirulina and cisplatin showing minimal tubular atrophy with dilatation, distortion and flattened lining affecting the tubules in this field (HX&E X 400).

Figure 5. Kidney of Cisplatin group the proximal tubule showed apoptotic body near the luminal border of the epithelium with few prominent nucleoli.

Figure 6. Cisplatin group tubular injury evidenced with apoptotic epithelial cells with shedding into lumen.

Figure 7. OSOM of rat receiving cisplatin and spirulina showing tubular atrophy with dilatation, distortion and flattened lining affecting 2 tubules surrounded by reaerating solid sheets and regenerating tubules in this field (HX&E X400).

Figure 8. OSOM of rat receiving cisplatin + spirulina showing lost brush border with partial preservation in some tubules.

Figure 9. Effects of pre- and post-treatment with spirulina 1400 mg/kg orally once daily for 21 days on the mRNA levels Bax in kidney of cisplatin-injected rats.

*compared to normal group

# compared to Cp group.

Figure 10. Effects of pre- and post-treatment with spirulina 1400 mg/kg orally once daily for 21 days on the mRNA levels SIRT in kidney of cisplatin-injected rats.

* compared to normal group

# compared to Cp group.

Figure 11. Different expression levels of SIRT1, BCL2 and GAPDH mRNA in study groups.